ID: 1038224803

View in Genome Browser
Species Human (GRCh38)
Location 8:25645828-25645850
Sequence GGCCACAGAGCCACTGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038224803_1038224811 3 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224811 8:25645854-25645876 GGGACACCCAAGCTGTGGAGGGG No data
1038224803_1038224813 8 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224813 8:25645859-25645881 ACCCAAGCTGTGGAGGGGCTGGG No data
1038224803_1038224816 21 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224816 8:25645872-25645894 AGGGGCTGGGCTTTCCTTTGAGG No data
1038224803_1038224809 1 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224809 8:25645852-25645874 GCGGGACACCCAAGCTGTGGAGG No data
1038224803_1038224810 2 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224810 8:25645853-25645875 CGGGACACCCAAGCTGTGGAGGG No data
1038224803_1038224812 7 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224812 8:25645858-25645880 CACCCAAGCTGTGGAGGGGCTGG No data
1038224803_1038224808 -2 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224808 8:25645849-25645871 CCAGCGGGACACCCAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038224803 Original CRISPR GGCCACAGAGCCACTGTCCC GGG (reversed) Intergenic
No off target data available for this crispr