ID: 1038224809

View in Genome Browser
Species Human (GRCh38)
Location 8:25645852-25645874
Sequence GCGGGACACCCAAGCTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038224803_1038224809 1 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224809 8:25645852-25645874 GCGGGACACCCAAGCTGTGGAGG No data
1038224804_1038224809 0 Left 1038224804 8:25645829-25645851 CCGGGACAGTGGCTCTGTGGCCA No data
Right 1038224809 8:25645852-25645874 GCGGGACACCCAAGCTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038224809 Original CRISPR GCGGGACACCCAAGCTGTGG AGG Intergenic
No off target data available for this crispr