ID: 1038224812

View in Genome Browser
Species Human (GRCh38)
Location 8:25645858-25645880
Sequence CACCCAAGCTGTGGAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038224804_1038224812 6 Left 1038224804 8:25645829-25645851 CCGGGACAGTGGCTCTGTGGCCA No data
Right 1038224812 8:25645858-25645880 CACCCAAGCTGTGGAGGGGCTGG No data
1038224803_1038224812 7 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224812 8:25645858-25645880 CACCCAAGCTGTGGAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038224812 Original CRISPR CACCCAAGCTGTGGAGGGGC TGG Intergenic
No off target data available for this crispr