ID: 1038224816

View in Genome Browser
Species Human (GRCh38)
Location 8:25645872-25645894
Sequence AGGGGCTGGGCTTTCCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038224803_1038224816 21 Left 1038224803 8:25645828-25645850 CCCGGGACAGTGGCTCTGTGGCC No data
Right 1038224816 8:25645872-25645894 AGGGGCTGGGCTTTCCTTTGAGG No data
1038224804_1038224816 20 Left 1038224804 8:25645829-25645851 CCGGGACAGTGGCTCTGTGGCCA No data
Right 1038224816 8:25645872-25645894 AGGGGCTGGGCTTTCCTTTGAGG No data
1038224807_1038224816 0 Left 1038224807 8:25645849-25645871 CCAGCGGGACACCCAAGCTGTGG No data
Right 1038224816 8:25645872-25645894 AGGGGCTGGGCTTTCCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038224816 Original CRISPR AGGGGCTGGGCTTTCCTTTG AGG Intergenic
No off target data available for this crispr