ID: 1038231079

View in Genome Browser
Species Human (GRCh38)
Location 8:25700848-25700870
Sequence GACCATGAACTGGTTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038231076_1038231079 -6 Left 1038231076 8:25700831-25700853 CCTTACAAATGGCCATTGACCAT No data
Right 1038231079 8:25700848-25700870 GACCATGAACTGGTTCTGACTGG No data
1038231075_1038231079 -5 Left 1038231075 8:25700830-25700852 CCCTTACAAATGGCCATTGACCA No data
Right 1038231079 8:25700848-25700870 GACCATGAACTGGTTCTGACTGG No data
1038231073_1038231079 16 Left 1038231073 8:25700809-25700831 CCAGTTTCACAAAGCATTCTTCC No data
Right 1038231079 8:25700848-25700870 GACCATGAACTGGTTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038231079 Original CRISPR GACCATGAACTGGTTCTGAC TGG Intergenic
No off target data available for this crispr