ID: 1038234853

View in Genome Browser
Species Human (GRCh38)
Location 8:25742788-25742810
Sequence CCCATCTGTTTGTAGAATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038234848_1038234853 22 Left 1038234848 8:25742743-25742765 CCTATCTCAAGGGAGTACACTAG No data
Right 1038234853 8:25742788-25742810 CCCATCTGTTTGTAGAATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038234853 Original CRISPR CCCATCTGTTTGTAGAATCC CGG Intergenic
No off target data available for this crispr