ID: 1038244516

View in Genome Browser
Species Human (GRCh38)
Location 8:25842917-25842939
Sequence GTCTATACACAGACTTAGTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038244516_1038244518 6 Left 1038244516 8:25842917-25842939 CCAAACTAAGTCTGTGTATAGAC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1038244518 8:25842946-25842968 GTGGTGCTCATGAGTCAATAAGG 0: 1
1: 0
2: 0
3: 5
4: 74
1038244516_1038244519 21 Left 1038244516 8:25842917-25842939 CCAAACTAAGTCTGTGTATAGAC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1038244519 8:25842961-25842983 CAATAAGGAGAACCCCAACGTGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038244516 Original CRISPR GTCTATACACAGACTTAGTT TGG (reversed) Exonic
902870445 1:19311021-19311043 GTCTGTGCAAAGACTTGGTTTGG - Intronic
905638599 1:39573486-39573508 GTGTACACACGGACTTGGTTGGG - Intronic
909680451 1:78285884-78285906 TTCTATACAATGTCTTAGTTTGG + Intergenic
911473037 1:98342128-98342150 ATATATACAAAGACTTAGTTTGG + Intergenic
917193058 1:172439127-172439149 GTCTATATACAGGCATACTTTGG - Intronic
917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG + Intronic
919441117 1:197634501-197634523 GCCTATACAGGAACTTAGTTTGG - Intronic
920790188 1:209082717-209082739 ATCCATACACACACTTATTTAGG - Intergenic
921234973 1:213117223-213117245 ATCTTTACACATACTTAATTGGG + Intronic
921675926 1:217976469-217976491 GTCCAAATACAGACTTAGTAAGG - Intergenic
1066070970 10:31811827-31811849 CTCTCTACAAAGAATTAGTTGGG - Intronic
1070183879 10:74041015-74041037 GTCTCTACACAAAATTAGTCGGG - Intronic
1071575383 10:86722026-86722048 GCCCATGCACAGACTTTGTTCGG + Intronic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1091611497 12:2014289-2014311 GACTAAACACAGGCTTATTTGGG - Intronic
1093878942 12:24382134-24382156 GTATATACACACATTAAGTTAGG + Intergenic
1095729421 12:45490484-45490506 GTCTTTACACAGACCTAGATGGG - Intergenic
1097449407 12:59717383-59717405 ATATCTACACAGAGTTAGTTTGG + Intronic
1099417381 12:82408242-82408264 TTCTATGCAGAGACTTAGATGGG + Intronic
1099996162 12:89781356-89781378 CTCTATACACAGACTGAGAAGGG - Intergenic
1101704443 12:107208615-107208637 GGCTATGCACAGACTTATATTGG - Intergenic
1112123792 13:96442180-96442202 GTCTTTACAAAAAATTAGTTGGG - Intronic
1113965995 13:114154581-114154603 GTCTAGACACAGACAGAGTAAGG - Intergenic
1117388271 14:55238388-55238410 GTCTCTACAAAAAATTAGTTGGG - Intergenic
1126555398 15:49982327-49982349 GTCTATACACAGCAGTAGCTAGG - Intronic
1126721581 15:51586676-51586698 GTATATAAATAGACTTAGTTTGG - Intronic
1127440608 15:59003271-59003293 GTCTCTACAAAAACTTAGCTGGG - Intronic
1131855551 15:96589839-96589861 GTATGTACACAGAATTTGTTTGG - Intergenic
1132155281 15:99491748-99491770 GTCCATACACAGGCTATGTTAGG + Intergenic
1146000726 17:29128798-29128820 GTCTATCCCCAGACTTAGCATGG + Intronic
1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG + Intergenic
1156011863 18:32505695-32505717 GTCTATACATATTCTTAGGTTGG + Intergenic
1157879155 18:51303733-51303755 CTCTAAACACAAACTTATTTAGG - Intergenic
1164923979 19:32111582-32111604 TTCTATTAAAAGACTTAGTTTGG + Intergenic
1166486000 19:43212785-43212807 GTCTAAACTCAGCCTTGGTTTGG - Intronic
927203151 2:20590884-20590906 GACTCTACACAGACTTGTTTAGG + Intronic
927342131 2:21994452-21994474 GTGAATACACAGACTTGGTGGGG + Intergenic
927899266 2:26807407-26807429 GTCTCTACAAAAACTTAGTTGGG + Intergenic
928690647 2:33794964-33794986 GTCTCTACAAAAACTTAGCTGGG + Intergenic
929483327 2:42333649-42333671 GTAGATTCACAGACTTACTTTGG + Intronic
930557788 2:52921771-52921793 TTCTTTGCACAGACTTATTTTGG + Intergenic
931400810 2:61929761-61929783 GTCTTTACAAAAAATTAGTTGGG + Intronic
935385405 2:102493907-102493929 GTCTATAGACAGACTTCTTGAGG + Intronic
939187140 2:138874209-138874231 TTGTATACACAGACTTGATTAGG - Intergenic
939472779 2:142645752-142645774 GTCTTTACATAGACTGAGTATGG - Intergenic
940114091 2:150188752-150188774 GGGTATACACAGATTTATTTGGG + Intergenic
940353134 2:152710843-152710865 ATCTATTCACAAACTTAGTGTGG - Intronic
942187099 2:173434271-173434293 GTCTAAACCCAGATTTAGTAAGG + Intergenic
942511961 2:176711986-176712008 GTTTTTTCACAGACTTAGATGGG - Intergenic
943625849 2:190198470-190198492 GTCTCTACAAAAACTTAGGTAGG + Intronic
943918438 2:193669121-193669143 GTCTGTCCACATACTTAGATTGG + Intergenic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1176049756 20:63112521-63112543 ATCTAGACACAGACATAGGTGGG + Intergenic
1183394838 22:37565893-37565915 TTCTATACACAGACTCACTTGGG + Intronic
950941500 3:16897492-16897514 GTCTTTAGAAAGAATTAGTTTGG + Intronic
956226154 3:66961468-66961490 ATGTATACACAGACTTAAATTGG - Intergenic
971081850 4:23221794-23221816 GTCTGTACACAGAGTCAGTGTGG - Intergenic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
978594181 4:110358971-110358993 GGTTATACACAGACTTTGTAAGG - Intergenic
980325906 4:131345658-131345680 CTCTAAAAACAGACTTAATTTGG + Intergenic
980747553 4:137038540-137038562 ACCTATACCTAGACTTAGTTAGG - Intergenic
982078145 4:151759769-151759791 GTATATACACAAAATTACTTGGG - Intronic
987729277 5:21747527-21747549 GTCAATAAACAGCCTGAGTTTGG - Intergenic
988348969 5:30075852-30075874 GTCTGCAGACAGAGTTAGTTTGG - Intergenic
991744967 5:69728895-69728917 TTATATACACGGACTTAATTTGG + Intergenic
991752737 5:69826331-69826353 TTATATACACGGACTTAATTTGG - Intergenic
991796537 5:70308624-70308646 TTATATACACGGACTTAATTTGG + Intergenic
991802356 5:70383065-70383087 TTATATACACGGACTTAATTTGG - Intergenic
991824347 5:70604209-70604231 TTATATACACGGACTTAATTTGG + Intergenic
991832056 5:70701459-70701481 TTATATACACGGACTTAATTTGG - Intergenic
991888916 5:71308179-71308201 TTATATACACGGACTTAATTTGG + Intergenic
992171626 5:74107559-74107581 GTCTGGAGACAGACTTGGTTTGG - Intergenic
998540443 5:142976591-142976613 TTCAATACACAGTCTTACTTAGG - Intronic
1000907953 5:166986255-166986277 GGACATACACAGACTTATTTTGG + Intergenic
1005787976 6:29265494-29265516 GTTTATACACAGTATAAGTTGGG - Intergenic
1009793234 6:68431967-68431989 GACTGTACATAAACTTAGTTGGG - Intergenic
1012897547 6:104967628-104967650 GTTTATACAAAAACTGAGTTGGG - Intronic
1014521121 6:122443411-122443433 GTCTACACACAGAATAAGGTTGG + Exonic
1022010707 7:26305776-26305798 GTCTGTCTACAGACTCAGTTTGG - Intronic
1023645157 7:42304251-42304273 GTCAATACACAGATATGGTTGGG - Intergenic
1028571470 7:92292035-92292057 CTCTATACATAGACATATTTTGG + Intronic
1032412464 7:131706998-131707020 GTCTCTACAAAAACTTAGCTGGG - Intergenic
1035001225 7:155613644-155613666 GTCTCTACAAAAAATTAGTTGGG + Intronic
1038244516 8:25842917-25842939 GTCTATACACAGACTTAGTTTGG - Exonic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG + Intronic
1044997477 8:97850861-97850883 GTCTATACACTGGCTGATTTCGG - Intronic
1045087753 8:98705250-98705272 GTCTCTACAAAAAATTAGTTGGG + Intronic
1049108719 8:140629669-140629691 GTCTCTCCACAAACTTAGCTAGG + Intronic
1052315274 9:27110061-27110083 ATCTATACACTGCCTTAATTGGG - Intronic
1059289258 9:113207863-113207885 GTCTAGCCAAAGACTTATTTGGG - Intronic
1185981818 X:4788174-4788196 GTCTGTTTACAGACCTAGTTAGG - Intergenic
1187071920 X:15897007-15897029 GTCTCTACAAAAAATTAGTTGGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1190700077 X:52981266-52981288 GTTCATACACAATCTTAGTTAGG - Intronic
1195932066 X:110088301-110088323 TTCTAAACTGAGACTTAGTTTGG + Intronic
1196307299 X:114119069-114119091 GTCCATCCTCAGTCTTAGTTTGG - Intergenic
1196595768 X:117543764-117543786 GTCTATGGTCAGACTAAGTTTGG - Intergenic
1198524441 X:137486453-137486475 GTAGATACACAGATTTATTTCGG - Intergenic
1199984938 X:152943733-152943755 CTCTATCCACAGACTTGGTGAGG + Intronic