ID: 1038246788

View in Genome Browser
Species Human (GRCh38)
Location 8:25865563-25865585
Sequence ATATGCCAAGCACCGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 9, 3: 82, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038246788_1038246791 30 Left 1038246788 8:25865563-25865585 CCTCAGCACGGTGCTTGGCATAT 0: 1
1: 0
2: 9
3: 82
4: 369
Right 1038246791 8:25865616-25865638 AGGGTTTCACCCTGTTGCCCAGG 0: 72
1: 4477
2: 54498
3: 185811
4: 308920
1038246788_1038246790 11 Left 1038246788 8:25865563-25865585 CCTCAGCACGGTGCTTGGCATAT 0: 1
1: 0
2: 9
3: 82
4: 369
Right 1038246790 8:25865597-25865619 TTCTTTTTTCTTTTGAGACAGGG 0: 28
1: 763
2: 15962
3: 24304
4: 49616
1038246788_1038246789 10 Left 1038246788 8:25865563-25865585 CCTCAGCACGGTGCTTGGCATAT 0: 1
1: 0
2: 9
3: 82
4: 369
Right 1038246789 8:25865596-25865618 TTTCTTTTTTCTTTTGAGACAGG 0: 26
1: 672
2: 15419
3: 22531
4: 39566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038246788 Original CRISPR ATATGCCAAGCACCGTGCTG AGG (reversed) Intronic
900225865 1:1533421-1533443 AGATGCCAAGCCCTGTGCTCAGG + Intronic
901561785 1:10077534-10077556 ATGTGCTAAGCACGGTGCTGGGG - Intronic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902642447 1:17775412-17775434 ATTAACCAAGCACCGGGCTGGGG + Intronic
902967200 1:20014247-20014269 AAGTGCCAAGAACCCTGCTGTGG - Intergenic
903325966 1:22568707-22568729 AAATGCCAGGCACCGTGCTGGGG + Intronic
903544480 1:24115159-24115181 GTATGCCAAGCACTGTTCTCGGG - Intergenic
903547579 1:24136269-24136291 ATGTGCCAGGCACTATGCTGAGG + Intronic
903640761 1:24858446-24858468 ATGTGCCAAGCACTGTTCTAAGG - Intergenic
903962663 1:27066507-27066529 ATGTGCCAGGCACCATGCTAAGG - Intergenic
903972269 1:27126697-27126719 ATGTGTCAGGCTCCGTGCTGAGG - Intronic
903989548 1:27256812-27256834 ATGTGCCAGGCATTGTGCTGAGG - Intronic
904415573 1:30359250-30359272 GGATGCCCAGCACTGTGCTGGGG + Intergenic
904575608 1:31503300-31503322 ATATGCTAAGCACACTGCAGGGG + Intergenic
904615284 1:31746211-31746233 GTGTGCCAAGCAGGGTGCTGAGG - Intronic
904802124 1:33100488-33100510 ATACTCAAAGCACCGTGCTGAGG + Intronic
904960559 1:34329466-34329488 TTGTGCCAAGCACCGTGCTAAGG - Intergenic
905527512 1:38650067-38650089 TTATGCCAGGCACAGTGCTGGGG + Intergenic
906071891 1:43022941-43022963 ATGTGCCAAGCCCTGTGATGGGG + Intergenic
906156285 1:43615913-43615935 ATGTGCCAGTCCCCGTGCTGGGG + Intronic
907527211 1:55060808-55060830 ACATGCCAGGCTCCATGCTGGGG + Intronic
907727911 1:57037169-57037191 ATTTGCAAATCACCATGCTGGGG + Intronic
908451761 1:64262933-64262955 GTATGCCAACCACTGTGCTGTGG - Intronic
909876168 1:80806496-80806518 ATCTGCCAAGCAGTGTGCTAGGG + Intergenic
910375884 1:86569853-86569875 ATGTGCCAGTCACCGTGCTGGGG - Intronic
913320787 1:117587090-117587112 AGAGGCCAAGGACTGTGCTGTGG + Intergenic
913462454 1:119102162-119102184 ATGTACCAAACACCGTGTTGAGG + Intronic
914830067 1:151164855-151164877 TTATGCCAGACACTGTGCTGAGG - Intronic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
915791365 1:158675179-158675201 ATATGACAAGCACTGTCCTCTGG + Intronic
915928541 1:160042678-160042700 ATGTGCCAGGCACTGTGCAGGGG + Intronic
916276466 1:162999372-162999394 ATTTGCCAAACACCATACTGGGG - Intergenic
916498129 1:165363827-165363849 TTATGCAAGGCACTGTGCTGAGG - Intergenic
916601018 1:166293651-166293673 ACATGCCAAGCACTGCTCTGGGG - Intergenic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
918316994 1:183330668-183330690 AAATGTTAAGCACAGTGCTGGGG + Intronic
918370969 1:183861150-183861172 ATATGCCAGGTACTGTGCTAAGG - Intronic
920118687 1:203639334-203639356 ATATGCCAAGCACTATGTTAAGG + Intronic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
921574185 1:216815237-216815259 ATGTGCCAGGCACCATGCTCAGG + Intronic
923695683 1:236248134-236248156 ATGTGCCAAGCACTGTTCTAGGG - Intronic
924030378 1:239879990-239880012 GTATGCCAATCACTGTGATGAGG + Intronic
924195796 1:241605547-241605569 ATGTGCCAGGCACTGTGCAGTGG + Intronic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
1062972030 10:1655263-1655285 TTAAGCCAAGCTCCATGCTGTGG + Intronic
1063343556 10:5291566-5291588 AAATGCCAAATACCTTGCTGTGG + Intergenic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1065171694 10:23036569-23036591 AGATGCCAAGTCCCTTGCTGGGG + Intronic
1065214472 10:23437484-23437506 ATGTGCCAAGCACGGTGTTAGGG + Intergenic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1065949544 10:30639483-30639505 ATATGCCAAGCCTGGTTCTGGGG - Intergenic
1067981704 10:51094026-51094048 CTGTGCCAAGCACCATTCTGGGG - Intronic
1068876097 10:61998500-61998522 AAATGGCAAACACCGTGCTTTGG - Intronic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069897151 10:71686976-71686998 CTCAGCCAAGCACCGTGCTCTGG + Intronic
1071393434 10:85198133-85198155 ATATTCCAAGCACTGTGCAAGGG - Intergenic
1072307431 10:94121099-94121121 ACATGCCAAGTGCTGTGCTGAGG + Intronic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072661007 10:97363512-97363534 GTGTGCCCAGCACTGTGCTGAGG - Intronic
1072695377 10:97599473-97599495 ATATGCCACGCACAGTTCTAAGG - Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073651036 10:105358436-105358458 ACATGCCAAGCTTAGTGCTGAGG - Intergenic
1074282965 10:112070284-112070306 CAATGCCTAGCACAGTGCTGGGG + Intergenic
1074461462 10:113641836-113641858 ACATGCAAAGCCCCATGCTGAGG + Intronic
1074692412 10:116018334-116018356 ATGTGCCCAGCACTGTGCTGTGG + Intergenic
1075956502 10:126527759-126527781 ACATGCCAGGCAGCGTGCTAAGG - Intronic
1076038992 10:127227020-127227042 ATAGGCCAAGTCCGGTGCTGGGG - Intronic
1077901112 11:6489542-6489564 ATATGCCAAGCACTGTGATAAGG - Intronic
1078090974 11:8264391-8264413 ATGTGCCAAGCACAGTTCTAAGG + Intronic
1078094322 11:8287352-8287374 ACATGCCAAGCACTGTCCTAGGG - Intergenic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078640574 11:13091893-13091915 ATGTGCCAAGAATTGTGCTGGGG + Intergenic
1078901766 11:15649219-15649241 ATGTGCCAAGCACTGTGCCCTGG - Intergenic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1079131635 11:17750185-17750207 ATGTGCCAGCCACGGTGCTGGGG - Intronic
1080494229 11:32799962-32799984 ATGTGCCAAGCACTGCGCTGAGG - Intergenic
1080758926 11:35228992-35229014 GTGTGCCAAGCACTGTGCTAGGG - Intronic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1082079150 11:47998663-47998685 GTATGCCAGGCACCTTGCCGGGG - Intronic
1082086572 11:48055211-48055233 ATGTGCCAGGCACCATGCTAGGG - Intronic
1082928048 11:58571743-58571765 ACATGCCAGGCACTGTGCTCAGG + Intronic
1083146854 11:60766453-60766475 CTATGCTAAGCACTGTGCTGGGG - Intronic
1084641687 11:70430076-70430098 AGATGCCAGGAACCGTGCTAGGG + Intronic
1085029777 11:73264137-73264159 ATGTGCCAAGCACTGTGCTAAGG - Intergenic
1085043273 11:73339234-73339256 AGATGCCAAGCACTGTGCTGGGG - Intronic
1085336239 11:75698693-75698715 ATGTGCCAAACACAGTTCTGGGG - Intergenic
1085467178 11:76731967-76731989 ATATGCCAGGCAGGGTCCTGGGG - Intergenic
1085826794 11:79856605-79856627 ATTTACCAAGCACTGTGCTAAGG - Intergenic
1086961810 11:92985600-92985622 ATATGCCAGGCACTGTTCTAAGG + Intergenic
1089582689 11:119491290-119491312 ATGTTCCAGGCACTGTGCTGAGG + Intergenic
1089701689 11:120248435-120248457 ATGTGCCAAGCACTGTGCTAAGG - Intronic
1089787320 11:120917367-120917389 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1091690365 12:2592294-2592316 ATGTGCCAGGCACCGTTCTGAGG + Intronic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1093625413 12:21340980-21341002 ATATTCCAAGCACTGTTCTAGGG + Intronic
1094142094 12:27191902-27191924 ATGTGCCAAGTATTGTGCTGGGG + Intergenic
1095558403 12:43536371-43536393 ATGTGCCAAGAACCGTTCTAGGG + Intronic
1095801512 12:46273889-46273911 ATATACCAAGCATTGTGCTTAGG - Intergenic
1096427906 12:51519960-51519982 ATATGCAAAGCACAGTGGTGAGG + Intergenic
1096534027 12:52259364-52259386 ATGTGCCTAGTACTGTGCTGAGG + Intronic
1098551280 12:71764031-71764053 ATGTGCCAAGCACTGTGCTTGGG - Intronic
1100233122 12:92630409-92630431 ATATGCCAGGCACTGAGCTATGG + Intergenic
1100461745 12:94806620-94806642 GTGTGCCAAGCACTGTGCTAAGG - Intergenic
1100527724 12:95435665-95435687 ATATGCCAAGCACTGTTTTTGGG + Intergenic
1100888043 12:99094128-99094150 ATGTGCCAGGCACTGGGCTGTGG + Intronic
1101554500 12:105795665-105795687 ATATGCCAGGCACCATGCTAAGG - Intergenic
1101836802 12:108301538-108301560 ATGTGCCAGGCACTGAGCTGGGG - Intronic
1101845228 12:108358177-108358199 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1102010844 12:109617515-109617537 ACACATCAAGCACCGTGCTGGGG - Intergenic
1102689039 12:114746171-114746193 ATGTGCCAGGCACCATGCTAGGG + Intergenic
1103444424 12:120984891-120984913 GTGAGCCAGGCACCGTGCTGAGG - Intronic
1103978009 12:124716320-124716342 GTGTGCCCAGCACAGTGCTGGGG + Intergenic
1104196498 12:126544205-126544227 ATAAGCCAAGCACCATGCTTAGG - Intergenic
1104512939 12:129398072-129398094 GTTTGCTAAGCACTGTGCTGAGG + Intronic
1105830996 13:24162649-24162671 GTGTGCCAAGCACTGTTCTGAGG + Intronic
1106322555 13:28655767-28655789 GTATGCAAGGCACTGTGCTGTGG + Intergenic
1106892408 13:34260035-34260057 ATGTGCCAAGTACAGTGCTTAGG - Intergenic
1109715819 13:66220493-66220515 ATGTGCCAAGCAATGTGCTAAGG + Intergenic
1110155520 13:72312171-72312193 ATATGCCAGGCACTATGCTATGG + Intergenic
1112248529 13:97756549-97756571 ATACGCCAAGCACAGGGCTTGGG - Intergenic
1113669547 13:112166275-112166297 GTATGCCAAGCTCCGTGCCTGGG + Intergenic
1114806388 14:25841800-25841822 AAAGGCCAAGCATTGTGCTGGGG + Intergenic
1115410444 14:33068083-33068105 CTATGCAAAGCACCATGCTAGGG + Intronic
1116827477 14:49686683-49686705 AGCTGCAAAGCACCGTGCTGGGG - Intronic
1117464053 14:55974716-55974738 ATGTGCCAAGCACCAGGCTAAGG + Intergenic
1117717748 14:58598204-58598226 CTGTTCCAAGCACTGTGCTGAGG - Intergenic
1118055556 14:62076127-62076149 ATATGCCAGGCACTGTGATAAGG + Intronic
1118501636 14:66367749-66367771 AGAGGCCAAGCACCAAGCTGGGG - Intergenic
1118608789 14:67523427-67523449 ATGTGCCATGCACTGTGCTAAGG + Intronic
1119552384 14:75524326-75524348 ATGTGCCAGGCATTGTGCTGGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1120182787 14:81362837-81362859 ATGTGCCAGGCAACATGCTGGGG + Intronic
1120210986 14:81633612-81633634 ACATGCCAAGCAAAGTGCTGGGG + Intergenic
1121246532 14:92464975-92464997 AGATGTCAGGCACGGTGCTGGGG - Intronic
1121688562 14:95857906-95857928 GTATGCCAAGCTCTGTGCTAGGG + Intergenic
1121729421 14:96175997-96176019 ATGTGCCAAGAACCATGATGGGG + Intergenic
1124346158 15:28922861-28922883 ATGCACCATGCACCGTGCTGAGG + Intronic
1125252540 15:37721947-37721969 ATTTGCCAGGCACAGTGCTGAGG - Intergenic
1125328583 15:38561923-38561945 CTATGGCAGGTACCGTGCTGGGG + Intronic
1125786998 15:42327964-42327986 GTGTGCCAAGCACTGTGCTAAGG + Intronic
1126070334 15:44860370-44860392 ATGTGCCAGGCACTGGGCTGAGG - Intergenic
1126087701 15:45024747-45024769 ATGTGCCAGGCACTGGGCTGAGG + Intronic
1126380142 15:48038135-48038157 ATATGCCAAGCACTGTTCTAAGG + Intergenic
1126691208 15:51290164-51290186 ATATGCCAGGCACTGTGCAAAGG - Intronic
1126865452 15:52932318-52932340 AAATGCCAGGCACTTTGCTGGGG + Intergenic
1127319060 15:57825104-57825126 ATATGCCTAGAACTGTGCTGGGG - Intergenic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1129705171 15:77790280-77790302 ATGTGCCAAGCAGTGTTCTGGGG - Intronic
1130150756 15:81309776-81309798 ACATGCCAAGCACTGTGCTCAGG + Exonic
1130969708 15:88722275-88722297 ACATGCCAAGCACTGTGCTAAGG - Intergenic
1131700242 15:94927763-94927785 ATAGGCCAAGCACTTTGCTGTGG + Intergenic
1131771919 15:95747031-95747053 ACATTCCAAGCACTGTGCTCAGG - Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1133124367 16:3635951-3635973 AGATGCCAAACACAGTTCTGGGG - Intronic
1133273501 16:4623274-4623296 ATGTGCCAGGCATCATGCTGAGG - Intronic
1134133059 16:11662783-11662805 ATGTTCCAAGCACTGTGCTAGGG - Intergenic
1134568397 16:15270696-15270718 GTATGCCAAGCACAGTGCCAAGG + Intergenic
1134734031 16:16485664-16485686 GTATGCCAAGCACAGTGCCAAGG - Intergenic
1134933467 16:18226617-18226639 GTATGCCAAGCACAGTGCCAAGG + Intergenic
1136241763 16:28949015-28949037 ATATGCCAGGCTGGGTGCTGTGG + Intergenic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137497216 16:48979825-48979847 ACATGCCAGGCACCATGCTAAGG + Intergenic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1139104727 16:63814767-63814789 ATATGGCAAGTGCCATGCTGAGG - Intergenic
1140133994 16:72189097-72189119 ATGTGCCAGGCACCGTGCTATGG + Intergenic
1141159369 16:81618825-81618847 ACGTGCCAGGCACCGTGCTGAGG + Intronic
1141843619 16:86591646-86591668 ATGTGTCAAGCTCTGTGCTGAGG + Intergenic
1142637323 17:1266074-1266096 ATGTGCCAGGTACCGTGCTAAGG + Intergenic
1143033312 17:3980264-3980286 ATGTGCCAAGCATGGTGCTGAGG - Intergenic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1145899955 17:28484093-28484115 AGATGCCAGGCACCTCGCTGGGG + Intronic
1147916841 17:43892938-43892960 ACATACCAGGCACAGTGCTGGGG - Intronic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148689495 17:49518947-49518969 ATATGCCAGGCAAGGTGCTAAGG - Intergenic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1149497069 17:57125729-57125751 GTATGCCAAGCATCCTGCTGGGG + Intergenic
1149854302 17:60066738-60066760 ATGTGCCAGGCATCATGCTGAGG + Intronic
1150716140 17:67574094-67574116 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1150801926 17:68289981-68290003 ATGTCCCAAGCACCGTTATGTGG - Intronic
1151538644 17:74752880-74752902 ATGTGCCAAGGACAGCGCTGGGG - Intronic
1151634104 17:75332284-75332306 AGATGCCAAGCACCGTACTCTGG + Intronic
1151642513 17:75406169-75406191 ATAGGCCGAACACTGTGCTGGGG + Intergenic
1151904308 17:77037765-77037787 ATGGGCCAAGCAAGGTGCTGGGG + Intergenic
1151961768 17:77409405-77409427 GCCTGCCAAGCACCGTGCAGTGG + Intronic
1151984678 17:77534635-77534657 ATCTGCCAAGCACCAGGCTGGGG - Intergenic
1152656553 17:81522541-81522563 GTGTGCCAGGAACCGTGCTGGGG - Intronic
1152987877 18:336050-336072 ATATGACAAGCACCGTGTTAAGG + Intronic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1154955030 18:21244774-21244796 AGAGGCCAAACACCGGGCTGAGG + Intronic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1156385539 18:36601517-36601539 ATATGCCAGGCACTGTCCTAAGG + Intronic
1157318923 18:46619534-46619556 ACATGCCCAGCACTGTGCTAGGG - Intronic
1157699885 18:49755538-49755560 ATGTGCCAGGCATTGTGCTGGGG + Intergenic
1157828189 18:50831443-50831465 ATGTGCCAAGTACTGTGCTGGGG - Intergenic
1158908601 18:62037893-62037915 ATATGCCAAGCCCTGTGCCAGGG - Intergenic
1160048990 18:75414340-75414362 ACATGCCAAGTACTGTGCTAGGG + Intronic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1161482763 19:4519021-4519043 GTATGCCAGGCACTGTTCTGTGG - Intergenic
1161609711 19:5235268-5235290 GTGTGCCAAGCATCGTGCTAAGG + Intronic
1161642238 19:5431567-5431589 ATGTGCCAAGCCTTGTGCTGAGG - Intergenic
1161673176 19:5625663-5625685 TGATGCCAGGCACTGTGCTGAGG + Intronic
1161758776 19:6155025-6155047 ATTTGCTAAGCACTGTGCTAAGG - Intronic
1162104205 19:8360348-8360370 ATATGCCAGGCACTGTACTGGGG - Intronic
1164437051 19:28239528-28239550 GCATGCCAAGCCCTGTGCTGTGG - Intergenic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1165224875 19:34347709-34347731 CTGTGCCCAGCACCCTGCTGTGG - Intronic
1165264940 19:34653403-34653425 ATATGCTAATCACCCTGCTTTGG + Intronic
1165343156 19:35226557-35226579 ATATGCCAAGCTCCATTCTAGGG - Intronic
1165707854 19:37989071-37989093 ACACGGCAGGCACCGTGCTGGGG - Intronic
1165733585 19:38162066-38162088 ATGTGCCAGACACCGTTCTGAGG - Intronic
1166130741 19:40744232-40744254 ATGTGCCCAGCACCGTGCTGAGG + Intronic
1166322555 19:42027634-42027656 AGATGCCCATCACAGTGCTGGGG + Intronic
924988618 2:292555-292577 ATAAGCTAAGCACAGTGATGGGG + Intergenic
925785448 2:7428083-7428105 ATATACCAAGCAGCTTGCTTGGG - Intergenic
926240384 2:11080769-11080791 ATGTGCTAAGCACTGTGCTCAGG + Intergenic
927710718 2:25324216-25324238 ATGTGCCAAGCACTGTGCTAAGG + Intronic
927711421 2:25328674-25328696 ACATCCCCAGCACAGTGCTGCGG + Intronic
928275152 2:29893966-29893988 ATGTGCCAAGCACTCTGCTAAGG - Intronic
930027712 2:47039489-47039511 CTAAGCCAAGCACAGTCCTGGGG - Intronic
931913066 2:66923339-66923361 ATGTGCCAAACACTGTCCTGTGG + Intergenic
932123354 2:69121233-69121255 ATGTGCCAAGCAATGTGCTAAGG - Intronic
932564931 2:72900310-72900332 ATAGGCCAAGGAAGGTGCTGAGG - Intergenic
934921855 2:98350293-98350315 ATATGTCAGGCACTGAGCTGAGG - Intronic
935290363 2:101604996-101605018 ATATGCCAGGCACTGTTCAGGGG + Intergenic
936684233 2:114809108-114809130 TTATGTCAAGCACAGTGCTTGGG + Intronic
936797838 2:116228406-116228428 ATATGCCAGGAACTGTGCTGGGG + Intergenic
937082151 2:119147830-119147852 GTGTGCCCAGCACCGTGGTGGGG - Intergenic
939504934 2:143033516-143033538 ATGTGCCAAGCATTGTGCTGGGG - Intronic
939953663 2:148505974-148505996 ATGTGCCAAGTACTGTGCTGAGG - Intronic
941310016 2:163915703-163915725 ATATGCCAGGCAATGTGCTGAGG - Intergenic
942156599 2:173135015-173135037 ATATGCCAAGCATTGTCCTGAGG - Intronic
942545585 2:177060447-177060469 ATGTACCAGGCACCATGCTGGGG - Intergenic
942799824 2:179861775-179861797 AGATGCCAAGCCCCGCGATGGGG + Intergenic
944195085 2:197044330-197044352 AAATGCCAGGCACCCTTCTGAGG - Intronic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
946148126 2:217746178-217746200 ATGTGCCAGGCACTGTCCTGTGG - Intronic
946728729 2:222688145-222688167 ATATGCCAAGCATCGTGTTATGG - Intronic
946921050 2:224582822-224582844 ATGTGCCAGGCACTGTTCTGGGG - Intronic
947373454 2:229471723-229471745 ATTTGCAAAGCACAGTGCTAAGG + Intronic
947410669 2:229835598-229835620 ATATTCCAAACAACCTGCTGAGG - Intronic
948030348 2:234812765-234812787 ATATGCCAGGCACATTGCTAGGG + Intergenic
1168767239 20:389932-389954 ATTTGCCATGTACCATGCTGTGG + Intronic
1168835957 20:877617-877639 ATATACCAAGAACCAGGCTGAGG + Intronic
1169812266 20:9620270-9620292 AAATACCAAGCCCAGTGCTGAGG - Intronic
1170347704 20:15405424-15405446 ATGGGCCCAGCACCGTGGTGTGG + Intronic
1170976727 20:21171939-21171961 ATATGTCCAGCACCTTGGTGGGG - Intronic
1171446310 20:25207079-25207101 GTTTGCCAAGGACCGTGCTGCGG - Exonic
1172227561 20:33315243-33315265 ATGTGCCAGGCACCATGCTGAGG - Intergenic
1172582034 20:36055969-36055991 ATATGCAAGGCACTGTACTGAGG + Intergenic
1172626052 20:36347480-36347502 ATGTGCCAAGCCCTGTGCTGGGG + Intronic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173347617 20:42215409-42215431 ATATGCCAAAGACCATGCTAGGG - Intronic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1174847496 20:53957282-53957304 ATATGCCAAGAACTATGTTGGGG - Intronic
1174854142 20:54026864-54026886 AGATGCCAAGTGCTGTGCTGGGG - Intronic
1174929962 20:54802762-54802784 ATGTGCCAGGCATTGTGCTGGGG - Intergenic
1175078372 20:56395289-56395311 GTATGCCAGGCACTGTGCTCAGG + Intronic
1175361742 20:58416891-58416913 CTATGCCAGCCACAGTGCTGGGG + Intronic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1179315002 21:40236220-40236242 ATATGCCAAGCACTGAGCCCAGG + Intronic
1182392529 22:30010927-30010949 GTATGCTAGGCACTGTGCTGGGG + Intronic
1182575274 22:31268740-31268762 ATATGCTAGGCACTGGGCTGAGG + Intronic
1183224222 22:36538290-36538312 TTATGCCAGGCACTGTGCTATGG + Intergenic
1183516739 22:38271261-38271283 ATGTGCCAGGCACTATGCTGGGG - Intronic
1183848353 22:40562296-40562318 ATATGCCTGGCACCTTGGTGTGG - Intronic
1184107696 22:42377906-42377928 ATGTGTCAAGCCCAGTGCTGTGG - Intergenic
1184234580 22:43176221-43176243 ACGTGCCAAGCACTGTTCTGGGG + Intronic
1184351234 22:43945512-43945534 ATGTGCCAAGTACCATGCTACGG - Intronic
1184472580 22:44704131-44704153 ATGTGCTAAGCACTGTGTTGAGG - Intronic
1184849553 22:47112489-47112511 CTCTGCCAAGCACAGAGCTGGGG - Intronic
1184993605 22:48186593-48186615 AGCTGCCAAACACCGTGCGGAGG - Intergenic
1185015944 22:48342683-48342705 ATATGCCACCCACCCTGATGTGG + Intergenic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
950172652 3:10850393-10850415 CTATGCCAGGCACCAGGCTGGGG + Intronic
950436568 3:12983803-12983825 TTGTGCCAGGCGCCGTGCTGAGG - Intronic
950966934 3:17152967-17152989 ATGTGCCAAACACTGTGCTGGGG - Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952424993 3:33166640-33166662 ATATGCCATACACCATGCTGTGG - Intronic
954116675 3:48470455-48470477 GTATGCCAAGCACCGTGCCAGGG + Intronic
954443942 3:50536556-50536578 ATGTGCCATGCACCCTGCGGAGG - Intergenic
955134104 3:56199035-56199057 ATATGACAGGCACTGTGCTAAGG + Intronic
955223916 3:57045565-57045587 ATATGCCAGACACCCTGCTGAGG + Intronic
955922761 3:63974675-63974697 ACATGCCAGGCACCATGCTACGG - Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
957576315 3:82013419-82013441 TTATGCCAAGCAACTTGCTTAGG + Intergenic
957891318 3:86362905-86362927 ATATGCAAAGCACTGAGGTGAGG - Intergenic
958999801 3:100950205-100950227 CTCTGCCAGGCACCGTGCTAGGG - Intronic
959637659 3:108593212-108593234 ATGTGCCAAGCACTGTCCTAAGG + Intronic
960262827 3:115588011-115588033 AAAAACCAAGCACCTTGCTGGGG + Intergenic
960488212 3:118278887-118278909 ATGTGCCAAGCACAGTACTGGGG + Intergenic
961620443 3:128219740-128219762 ACATGCCAAGCACTATGCTAAGG - Intronic
961621073 3:128225578-128225600 ATGTGCCAGGCACGGTGCTGGGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
962036438 3:131656606-131656628 ATATGCCAAGCACTGTTTTAGGG + Intronic
962935558 3:140077358-140077380 ATAAGCCAATCAGCCTGCTGTGG - Intronic
963227533 3:142877524-142877546 TTGTGCCAAGCACTGTGCTAAGG + Intronic
965611905 3:170553210-170553232 ATATGCTAGGCACTGTGCTTGGG - Intronic
966424708 3:179768659-179768681 ATGGGCCAGGCACAGTGCTGGGG - Intronic
966580785 3:181560162-181560184 CTATGCCAGGCACCATGCTAGGG + Intergenic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
967108395 3:186272050-186272072 ATGTGCCAGGCACCATGCTAGGG - Intronic
968980441 4:3846129-3846151 ATGTGCCAAGCAGTGGGCTGGGG + Intergenic
969098893 4:4754253-4754275 ATATGCCAAGCACCTTATTCTGG - Intergenic
969276736 4:6140866-6140888 ATACACCAGGCACTGTGCTGAGG - Intronic
973340182 4:48995557-48995579 ATATGCCCAGATCCCTGCTGGGG - Intronic
974384489 4:61187300-61187322 ATATGCCTAGAAACTTGCTGGGG - Intergenic
975613375 4:76222743-76222765 ATATGCCAAGCTCTGTTCTAAGG + Intronic
976262862 4:83162550-83162572 ATATGCCAAGCACCATTTTAAGG - Intergenic
977565657 4:98577878-98577900 ATGTGCCGGGCACTGTGCTGAGG - Intronic
977841591 4:101713343-101713365 ATAATCCAAGTACTGTGCTGGGG + Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978475756 4:109128044-109128066 AAATTCCAAGCACCTAGCTGGGG + Intronic
978955061 4:114602566-114602588 GTGTGCCAAGCACTGTGCTCTGG + Intronic
980897205 4:138871367-138871389 ATATGCCCAGCACCGGTCTGAGG - Intergenic
980993240 4:139757177-139757199 AAATGCCAAGTAGGGTGCTGTGG - Intronic
981064294 4:140464915-140464937 AAATGCCAAGCACTTAGCTGAGG - Exonic
981799716 4:148641369-148641391 ATCTTCCAAGAACCATGCTGGGG - Intergenic
983843808 4:172490937-172490959 ATATGCCAAGCAAGGAGATGGGG + Intronic
984090821 4:175373199-175373221 GTATGCCAGGCACTGTGCTATGG - Intergenic
987776651 5:22375176-22375198 ATATGCCAAGAACAATTCTGAGG + Intronic
988514994 5:31896525-31896547 ATGTGCCAAGCCCTGTGCTAAGG + Intronic
988705180 5:33719010-33719032 ACATGCCAGGCAACATGCTGAGG + Intronic
990305663 5:54492258-54492280 ATATGGACAGCACGGTGCTGTGG + Intergenic
990539716 5:56760275-56760297 ATATGCCAAGCAGCACGCTCAGG + Intergenic
990580575 5:57163859-57163881 ATCTTCCTAGCACAGTGCTGAGG + Intergenic
990662287 5:58029650-58029672 ACATTCCAACCACGGTGCTGGGG + Intergenic
991284882 5:64961849-64961871 ATATGTCAAGCACTATGCTAGGG - Intronic
992035443 5:72770089-72770111 ATATGCCATGCACTGTGCCAAGG - Intergenic
992435008 5:76747824-76747846 ATAAGCCAAACACCGAGCTGTGG + Intergenic
994648366 5:102497933-102497955 ATATCTCAAGCACCGAGCTTCGG - Intronic
996589451 5:125129532-125129554 GTGTGCCAAGCTCCGTGCTGGGG + Intergenic
997258750 5:132449270-132449292 ATATGCCAGGCACTGTCCTAGGG - Intronic
997401295 5:133605033-133605055 ATGTGCTAAGCATTGTGCTGAGG + Intronic
997662080 5:135597041-135597063 ATATGCTAGGCACTATGCTGGGG - Intergenic
997693578 5:135844195-135844217 CTGTGCCCAGCCCCGTGCTGAGG - Intronic
997696009 5:135861543-135861565 ATATGCCAGACATTGTGCTGAGG - Intronic
997720643 5:136076040-136076062 GTATGCCAAGCACTATGCTAGGG + Intergenic
998503054 5:142650225-142650247 CTATGCCAGGCACCATGCTAGGG + Intronic
999265856 5:150266485-150266507 CTGTGCCAAGCACTGTGCAGAGG + Intronic
999416021 5:151396735-151396757 ATGTGACAAGCACTGTGCTAAGG + Intergenic
999432680 5:151537641-151537663 ATGTGCCAAGCATTGTACTGGGG - Intronic
999675771 5:154000938-154000960 TTATGCCAGGCACCATGCTAAGG + Intronic
999679987 5:154047991-154048013 ATCAGCCAAGCACTGTGCTAGGG - Intronic
1000365445 5:160486491-160486513 ATGTGCCAAGCACTGTGCTCAGG + Intergenic
1001133074 5:169080344-169080366 ATGTGCCAAGCACTGTGCTAGGG + Intronic
1001770389 5:174291756-174291778 ATATGCCATGCATTGTGCTAAGG + Intergenic
1002021738 5:176368006-176368028 ATGTGCCAGGCATTGTGCTGAGG + Intronic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1004186374 6:13424906-13424928 ATATGCCAAGCAGTATTCTGAGG + Intronic
1005034402 6:21542506-21542528 ATATCCCAAGCACTGTTCTTAGG + Intergenic
1006525488 6:34601226-34601248 ATGCGCCAGGCACTGTGCTGAGG - Intronic
1006749810 6:36369724-36369746 GTATACCAGGCACTGTGCTGAGG - Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1008075879 6:47145970-47145992 ATTTGCCAAGCACTGTGTTTAGG + Intergenic
1009353696 6:62712927-62712949 ATTTGCAAAGCACGATGCTGAGG + Intergenic
1011455707 6:87546392-87546414 TTATGACAAGCACAGTGGTGGGG + Intronic
1012211416 6:96522349-96522371 ATTTGCCAAGTACTGTACTGGGG - Intronic
1012739336 6:102994622-102994644 ATATGCCAAACTCTGTGCTAAGG - Intergenic
1012987732 6:105892930-105892952 ATGTCCCAAGCACTGTGCTGGGG - Intergenic
1013008795 6:106101017-106101039 GTATGCCATGCCCAGTGCTGAGG + Intronic
1014086068 6:117345518-117345540 ATATGTCAGGCACCCTCCTGGGG - Intronic
1015776951 6:136823601-136823623 AAAGGCCAAGCGCCGTGCGGTGG + Intronic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1016651244 6:146463464-146463486 ATGTGCCAGACACTGTGCTGAGG - Intergenic
1016889078 6:148987897-148987919 TTATGCCAAGCTCAGTGGTGAGG + Intronic
1016896839 6:149061811-149061833 ATGTGCCAAGGACTTTGCTGTGG - Intronic
1017980314 6:159395365-159395387 AAAAGCCAAGCACCGTGGTGGGG + Intergenic
1018463828 6:164024186-164024208 ATAGGACAAGCTCCCTGCTGGGG - Intergenic
1018569127 6:165188261-165188283 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1019968286 7:4519218-4519240 ATATGCCAGGCTGGGTGCTGGGG - Intergenic
1021916198 7:25435007-25435029 ATGTGCCTAGCTCCGTGCTCTGG - Intergenic
1022032607 7:26506049-26506071 ATATGTCAAGCACTGGGCTAAGG - Intergenic
1023001177 7:35809371-35809393 ATATGCCAGGCATCATGCTAAGG - Intronic
1023628053 7:42136454-42136476 ATGTGCCAAGCACTGGGCTGAGG - Intronic
1025072892 7:55916578-55916600 ATATGCCAGGCATGGTGCTTGGG - Intronic
1025871597 7:65439355-65439377 ATGTACCAAGCACTGTGCTAGGG - Intergenic
1026375130 7:69742422-69742444 ACATGCCAAGCATAGTGCTAAGG - Intronic
1026377193 7:69763742-69763764 ACATGCCAAGCACTGTTCTAAGG - Intronic
1028056582 7:86252659-86252681 ATGTGGCCAGCACAGTGCTGGGG - Intergenic
1029897957 7:104006289-104006311 ATATGCCAAGCATCGTGCTAGGG + Intergenic
1030014334 7:105203602-105203624 ATGTGCCAAGCATGGTGGTGTGG - Intronic
1031460341 7:122040935-122040957 CTATGCCAAGCGCCATGCAGTGG + Exonic
1032889343 7:136177761-136177783 TTAAGCCAAGCACTGTGCTAGGG - Intergenic
1033262859 7:139858637-139858659 AGATACCAAGCATGGTGCTGGGG - Intronic
1034662210 7:152781432-152781454 ATGTGCCAGGCACTGTGCCGGGG + Intronic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037924127 8:22831516-22831538 ATATACTAAGCACCATGCTAAGG + Intronic
1037938190 8:22929128-22929150 ATGTGCCAGGCACCTTACTGAGG - Intronic
1038246788 8:25865563-25865585 ATATGCCAAGCACCGTGCTGAGG - Intronic
1038833904 8:31097146-31097168 ATATGCCAAGCACTGCACTGGGG - Intronic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041626970 8:60041276-60041298 ATATACCAAGGACAGTGATGCGG - Intergenic
1045074420 8:98547432-98547454 ATATGTGAGGCACAGTGCTGGGG - Intronic
1045471684 8:102518319-102518341 GTGTGCCAAGCACTGTGCTAAGG + Intergenic
1045664933 8:104474113-104474135 ATATAGCAAGCACTGTGCTGTGG - Intergenic
1046779056 8:118195761-118195783 ATGTGCCAAGCATTGTGCTTGGG - Intronic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1047842841 8:128772742-128772764 ATATACCATGCACTGTGCTAAGG - Intergenic
1048153975 8:131923945-131923967 AAATGCCAATCACAGTGCTGCGG - Intronic
1048284518 8:133131317-133131339 ATTTGCCAGGTACTGTGCTGCGG + Intronic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1048557804 8:135497690-135497712 ATATATCAAGCACTGTGCTTAGG + Intronic
1048828684 8:138454908-138454930 ACATGCCAAGCCCTGGGCTGAGG - Intronic
1049095029 8:140543689-140543711 ATGTGCCAGGCACCGTGCCAGGG + Intronic
1050267190 9:3903616-3903638 ATATGCCAGGCACTGTTCTAGGG + Intronic
1050670774 9:7994768-7994790 ACATGACAAGCACAGTGCTCTGG + Intergenic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1050810863 9:9745796-9745818 ATATGAAAAGCACTGTGATGGGG - Intronic
1050880186 9:10689433-10689455 ATATGCCAGGCATTGTTCTGAGG - Intergenic
1051501716 9:17785243-17785265 ATATGCCAAGTGCCTTGATGGGG - Intronic
1051809744 9:21034972-21034994 CTATGCCAAGCACTGTACTAGGG - Intergenic
1051997728 9:23238373-23238395 AAATGCCATGCACACTGCTGAGG + Intergenic
1053114825 9:35490917-35490939 ATGTGCCAGGCACCGTGCTGGGG - Intronic
1055218271 9:73894900-73894922 ATATTCCAGGCACTGTACTGGGG - Intergenic
1056553554 9:87671156-87671178 AGATGCAAAGCACCTTGCTGCGG + Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057470365 9:95351063-95351085 ATGTGCAAAGCCCGGTGCTGGGG + Intergenic
1057695165 9:97317997-97318019 ATGAGCCAAGCACAGTGCTAGGG + Intronic
1057723521 9:97552517-97552539 ATGTGCCAGGCACCTTTCTGGGG - Intronic
1057820393 9:98325756-98325778 ATCTGCCAAGCTCCATGCTGTGG - Intronic
1059306976 9:113361407-113361429 ATATGTGAAGCACTGTGCTATGG + Intronic
1059723254 9:116982340-116982362 ATGTGCCAAAGACTGTGCTGAGG - Intronic
1060139711 9:121199982-121200004 ATATGCCAAGCAATGTGCTAAGG + Intronic
1060239909 9:121894113-121894135 ATATGCCAAGCACTGGGCACGGG + Intronic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060437033 9:123602548-123602570 ACTTGCCAACCACTGTGCTGAGG - Intronic
1060730844 9:126036059-126036081 ATGTGCCAAGCACTGTGCTAAGG + Intergenic
1060803704 9:126561885-126561907 AAATGCTTAGCACGGTGCTGGGG - Intergenic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187744124 X:22389600-22389622 ACATGCCAAACACCCTGCTCAGG - Intergenic
1190279617 X:48921043-48921065 ATGTGCCAAGCACTGTGCCCAGG + Intergenic
1191666025 X:63703596-63703618 ATGTACCAGGCACTGTGCTGGGG + Intronic
1192344647 X:70290859-70290881 ATGTGCCAAGCACTGTGCTTGGG + Intronic
1192546902 X:72021886-72021908 ACATGCCAAGTAAAGTGCTGGGG - Intergenic
1192588944 X:72343786-72343808 ATAAGCCAGGCACAGTGATGTGG - Intronic
1192848396 X:74928422-74928444 ATGTGCCAAGCAGTGTTCTGAGG - Intergenic
1195454603 X:105053391-105053413 CTATGCCAGGCACCATGCTATGG + Intronic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1195968059 X:110447339-110447361 ATATGCCAAGAATGGGGCTGAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1198161448 X:134012610-134012632 ATGTTCCAAGCACTGTGCTAGGG + Intergenic
1198282053 X:135151976-135151998 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198284354 X:135174963-135174985 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198286743 X:135198439-135198461 ATATGCCAAGCACTGGGCAAAGG - Intergenic
1198288906 X:135220546-135220568 ATATGCCAAGCACTGGGCTAAGG + Intergenic
1198639844 X:138744483-138744505 AAATGCCACGCACTGTGCTGAGG - Intronic
1198691885 X:139293446-139293468 AGACGCCAAGCACTGTGCTAAGG - Intergenic
1199444751 X:147909641-147909663 ATATGCCAAGCAGTGTAATGAGG + Intergenic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199822300 X:151461487-151461509 ACATGCTAGGCACTGTGCTGAGG - Intergenic
1199988809 X:152972310-152972332 GTGTGCCAAGCACTGTGCAGAGG + Exonic
1200675820 Y:6145185-6145207 ATTTGCCAAGGCCCGTGTTGAGG - Intergenic