ID: 1038248014

View in Genome Browser
Species Human (GRCh38)
Location 8:25877341-25877363
Sequence TAGGCTAGCATACCTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038248010_1038248014 -8 Left 1038248010 8:25877326-25877348 CCTCTCCTCTCCGCCTAGGCTAG 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1038248014 8:25877341-25877363 TAGGCTAGCATACCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038248014 Original CRISPR TAGGCTAGCATACCTCCTCC AGG Intronic
No off target data available for this crispr