ID: 1038255992

View in Genome Browser
Species Human (GRCh38)
Location 8:25951617-25951639
Sequence GAGAATACACACACTTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038255985_1038255992 30 Left 1038255985 8:25951564-25951586 CCTTTTAGACAAAGAGGACTCTC 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1038255992 8:25951617-25951639 GAGAATACACACACTTAGCTAGG No data
1038255990_1038255992 1 Left 1038255990 8:25951593-25951615 CCTGGAAATTCACTTGGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 1038255992 8:25951617-25951639 GAGAATACACACACTTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038255992 Original CRISPR GAGAATACACACACTTAGCT AGG Intronic
No off target data available for this crispr