ID: 1038256908

View in Genome Browser
Species Human (GRCh38)
Location 8:25958660-25958682
Sequence GGTTCCCTGTTGAGTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038256900_1038256908 25 Left 1038256900 8:25958612-25958634 CCCAGCATGGACCAACTCCAGCC 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG No data
1038256899_1038256908 30 Left 1038256899 8:25958607-25958629 CCATTCCCAGCATGGACCAACTC 0: 1
1: 1
2: 0
3: 17
4: 200
Right 1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG No data
1038256901_1038256908 24 Left 1038256901 8:25958613-25958635 CCAGCATGGACCAACTCCAGCCC 0: 1
1: 0
2: 4
3: 182
4: 518
Right 1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG No data
1038256903_1038256908 8 Left 1038256903 8:25958629-25958651 CCAGCCCAGCTTCTTCTAATTTT 0: 1
1: 0
2: 2
3: 40
4: 543
Right 1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG No data
1038256905_1038256908 3 Left 1038256905 8:25958634-25958656 CCAGCTTCTTCTAATTTTTTAAG 0: 1
1: 0
2: 5
3: 69
4: 808
Right 1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG No data
1038256904_1038256908 4 Left 1038256904 8:25958633-25958655 CCCAGCTTCTTCTAATTTTTTAA 0: 1
1: 0
2: 12
3: 142
4: 1260
Right 1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG No data
1038256902_1038256908 14 Left 1038256902 8:25958623-25958645 CCAACTCCAGCCCAGCTTCTTCT 0: 1
1: 0
2: 3
3: 54
4: 549
Right 1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038256908 Original CRISPR GGTTCCCTGTTGAGTGCTAT TGG Intronic
No off target data available for this crispr