ID: 1038257796

View in Genome Browser
Species Human (GRCh38)
Location 8:25966648-25966670
Sequence CTCAAAGAGGAGATGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038257796 Original CRISPR CTCAAAGAGGAGATGGGCCA AGG (reversed) Intronic
901000438 1:6146447-6146469 CACAGAAGGGAGATGGGCCATGG + Intronic
901689205 1:10961457-10961479 CTCAGAGCGGAGATGAGCCCAGG + Intronic
902548636 1:17206186-17206208 CTCAAAGAGGAGCTGGGTGCTGG + Intronic
903269060 1:22176554-22176576 AGCAGAGTGGAGATGGGCCAGGG + Intergenic
903305095 1:22407778-22407800 GTCAGAGAGGAGAGTGGCCATGG + Intergenic
904415613 1:30359475-30359497 TGCAAAGAGGAGAGGGGCCAAGG - Intergenic
904484508 1:30815935-30815957 CTCAGAGAATAGCTGGGCCAGGG + Intergenic
904599739 1:31666825-31666847 CTCATGGAGGAAATGGGACAGGG - Intronic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
905867311 1:41382994-41383016 GCCAACTAGGAGATGGGCCAGGG + Exonic
905881580 1:41467571-41467593 CTCAGAGAGGACATGGGACTTGG - Intergenic
906512447 1:46418205-46418227 CTCCACGAGGACAGGGGCCAGGG - Intergenic
906580286 1:46930238-46930260 CTCAAAGCGGAGCAGGGTCAGGG + Exonic
906584943 1:46967797-46967819 CTCAAAGCGGAGCAGGGTCAGGG + Intergenic
906603440 1:47148652-47148674 CTCAAAGCGGAGCAGGGTCAGGG - Exonic
906666524 1:47626025-47626047 CAGAAAGTGGACATGGGCCATGG - Intergenic
907733455 1:57089470-57089492 AACAAAAGGGAGATGGGCCAGGG + Intronic
908533623 1:65056966-65056988 CACAGAGAGAAGAGGGGCCAGGG - Intergenic
909675477 1:78234835-78234857 TTCAATTAGGAGAGGGGCCAAGG + Intergenic
910262081 1:85302698-85302720 CTCAAAGAGTGGGTAGGCCATGG - Intergenic
910710412 1:90174011-90174033 CACAATGAGGAGATTGGACAAGG - Intergenic
912514984 1:110211572-110211594 CTGAAGGAGGAGATGGCCAAGGG + Exonic
913278335 1:117160781-117160803 CTGGAAGAGGAGAAGAGCCAAGG - Intronic
915419188 1:155766094-155766116 CTCAAAGAGAAGAGGAGTCAAGG - Exonic
917503150 1:175604165-175604187 CCAGAGGAGGAGATGGGCCAAGG + Intronic
917510062 1:175662416-175662438 CACCAAGAGGAGACAGGCCAGGG - Intronic
917779506 1:178377507-178377529 ATAATATAGGAGATGGGCCAAGG + Intronic
917968008 1:180190635-180190657 CTCCAAGGGGAGAGGGGGCAGGG + Intronic
918454846 1:184699356-184699378 CTCAAAGAGGAAAAGGGCCATGG + Intronic
918515214 1:185356112-185356134 CGGGAAGAGGAGAAGGGCCAAGG + Intergenic
919127755 1:193416772-193416794 TGCAAAGAGGAGAGGGGCAAAGG - Intergenic
919748440 1:201022754-201022776 TCCCAAGAGGAGATGGGCCTAGG - Intronic
919769328 1:201147225-201147247 CTCATAGAGGAGAGCGGCCCTGG - Intronic
921276949 1:213530203-213530225 GAAAAACAGGAGATGGGCCAAGG - Intergenic
921893882 1:220379415-220379437 AACAAAGAGGAGTTTGGCCAGGG - Intergenic
923024558 1:230194487-230194509 GTCAGAGAGGGGATGGGCCCAGG - Intronic
923034391 1:230274347-230274369 CTCAAAAAGGAAATGGGTCACGG - Intronic
923157609 1:231292357-231292379 CTGAAAGAGGGGTTGTGCCAGGG + Intergenic
924460268 1:244252938-244252960 CAAAAAAAGGAGATGGGCAATGG - Intergenic
1062906295 10:1181962-1181984 CTCACAGTGGAGATGGGACATGG - Exonic
1064198163 10:13262355-13262377 ATCAATGAGGAGATGGGTCCAGG - Intergenic
1064295685 10:14077041-14077063 CTCACAGAGGTCCTGGGCCAAGG + Intronic
1064599336 10:16977455-16977477 GTCAAAGAAGAAATCGGCCATGG + Intronic
1065207711 10:23372974-23372996 CCCAAAGAGGAGAGGTGCTAGGG + Intergenic
1066483224 10:35817743-35817765 CACAAGGAGCAAATGGGCCATGG - Intergenic
1067248410 10:44565957-44565979 CTCTAAGAGGAGACAGGCCTGGG + Intergenic
1067718481 10:48708221-48708243 CTCGAAGAGGAGCTGGGGGAAGG + Intronic
1069413909 10:68181153-68181175 CTCACAAAGGAGATGAGGCAAGG + Intronic
1071495222 10:86163300-86163322 CTCAAGGACAGGATGGGCCATGG - Intronic
1072662230 10:97370174-97370196 CTCGAAAAGGAGGTGGGTCAGGG + Exonic
1073214393 10:101828613-101828635 CTCAAGGAGGTGAGGGGACAAGG - Exonic
1073343612 10:102764986-102765008 CTCAAAGCAGAGCTGGGCCATGG - Intronic
1074392116 10:113066901-113066923 CCCAATGAGGAGATGGGCTAAGG - Intronic
1075674035 10:124283459-124283481 CGCAAAGACGAGATGGAGCAAGG - Intergenic
1075845562 10:125542508-125542530 GGAGAAGAGGAGATGGGCCAAGG + Intergenic
1077213917 11:1387297-1387319 TTCACAGAGGAGCTGGGACATGG + Intergenic
1077722607 11:4643538-4643560 CTCAAACAGGAGAATGGCAAAGG - Exonic
1078421412 11:11216048-11216070 CTCAGAGTAGGGATGGGCCAGGG - Intergenic
1078642292 11:13108031-13108053 CTAAGAGAAGAGATGGGCCAAGG - Intergenic
1079770027 11:24446836-24446858 CTCAAAGAGGGGGTGTGTCAGGG - Intergenic
1083779090 11:64909013-64909035 CTCTTAGAGGAGAAGGGCGAGGG + Exonic
1084904180 11:72333468-72333490 CTCAAAGGAGAGAGTGGCCAAGG - Intronic
1084946302 11:72640651-72640673 GTCAGAGAGGAGTTGGGGCAGGG - Intronic
1085405059 11:76256763-76256785 CTCAATGAGGGGCTGGCCCAAGG + Intergenic
1086131879 11:83409601-83409623 CTCAAAGAGCAGGTGGGCTCTGG - Intergenic
1087601665 11:100324405-100324427 CTCAAAGGGGAAGTGGGGCATGG + Intronic
1091037612 11:132247646-132247668 TTCAAGCAGGAGGTGGGCCATGG + Intronic
1094500862 12:31019852-31019874 CTGATAGAGGAGATGGGGCGGGG + Intergenic
1094745614 12:33341286-33341308 GTCAGAGAGGAGATGAGCCGTGG - Intergenic
1096551750 12:52377862-52377884 CTCCAAGAGGACATGGGGCCAGG + Exonic
1097305733 12:58067100-58067122 CTGGAAGAGGAGATGGCCCCAGG + Intergenic
1097708071 12:62888577-62888599 TTCAAGGAGGAAGTGGGCCATGG + Intronic
1099084411 12:78227221-78227243 GTCAAAGAGGAGTTTGGGCATGG + Intergenic
1101858304 12:108462685-108462707 ATCACAGAGGAGAAGGGCCAGGG - Intergenic
1102490163 12:113285819-113285841 CTCAAAGAGGAGACCGAGCATGG + Intronic
1102734838 12:115150245-115150267 CTCAAACAGCAGAAGGGGCAAGG + Intergenic
1102854977 12:116286014-116286036 CTCAAAGAGGAGTATTGCCAGGG - Intergenic
1103415146 12:120738365-120738387 CTCAAAGATGAGGTTGGCCGTGG - Exonic
1104192238 12:126493332-126493354 CTCAAAGAAGACAGGGGACAAGG - Intergenic
1105678860 13:22705334-22705356 CTCCATGAGGAGCTGGGCCGGGG + Intergenic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1108826964 13:54423881-54423903 CTCAAATAAGAGATGGCCCCAGG - Intergenic
1109194944 13:59368483-59368505 CTCTCAGAGGAGATGAGACAAGG + Intergenic
1109589749 13:64462835-64462857 GTCAGAGAGGAGATCAGCCATGG + Intergenic
1114307050 14:21433022-21433044 GAGAAAGAGGAGCTGGGCCATGG - Intronic
1117049686 14:51847673-51847695 ATCACAGACGAGAGGGGCCATGG + Intronic
1118279177 14:64412965-64412987 CCCACAGAGGAGATGGTGCAGGG + Intronic
1119564829 14:75619685-75619707 CTCAAGGAGGAAATTGGCTATGG - Intronic
1119568828 14:75651832-75651854 CTCAGAGAGGAAATGCCCCAGGG + Exonic
1121625531 14:95383140-95383162 CTCAAAGATGGGGTGGGCCCAGG + Intergenic
1121635302 14:95449988-95450010 CTCCAAGAGCCGCTGGGCCAGGG + Exonic
1122107991 14:99474024-99474046 TTAAAAGAGGAACTGGGCCAGGG + Intronic
1122118830 14:99541087-99541109 GTCACAGAGGTGATGGGACATGG - Intronic
1122281763 14:100627648-100627670 CTCAAAGAGAAGAGGAGGCAGGG - Intergenic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1122584699 14:102797121-102797143 CACAGAGAGGAGACAGGCCAAGG - Intronic
1122768881 14:104088351-104088373 CTCAGAGAAGGGATGGGTCAAGG - Intronic
1122874350 14:104656672-104656694 TTCATAGATGAGATGGGGCACGG + Intergenic
1123159889 14:106268151-106268173 CTAACAGAGAGGATGGGCCAGGG - Intergenic
1124892743 15:33748040-33748062 TTCCATGCGGAGATGGGCCAGGG + Intronic
1125782163 15:42279364-42279386 CTCAAAATGCAGGTGGGCCAGGG + Intronic
1128523593 15:68391555-68391577 CCAACAGGGGAGATGGGCCATGG + Intronic
1128832097 15:70779002-70779024 CCCAAAGAAGAGATCGGCTAGGG - Intergenic
1129699903 15:77761870-77761892 CTCAAAGAGGCTATATGCCAGGG - Intronic
1130154248 15:81335931-81335953 TGCAAGGAAGAGATGGGCCATGG + Intronic
1132092419 15:98957134-98957156 ATCAAAGAGGAGATGGAGCCTGG + Exonic
1134310226 16:13069841-13069863 CTCACAGGGCAGAAGGGCCAAGG - Intronic
1138445323 16:57059614-57059636 CTAAAGGAGGAGAGGGCCCAGGG - Intronic
1139574694 16:67833561-67833583 CTCAGAGAGGAGCAGGGCCTGGG - Intronic
1139605388 16:68014529-68014551 CACATAGAGGTGATAGGCCAAGG - Intronic
1141213728 16:82004762-82004784 CTGGAGGAGGAAATGGGCCAGGG + Intronic
1141325793 16:83058186-83058208 CTCACAAAGGAGAGGGGCTAAGG - Intronic
1141951666 16:87343766-87343788 CTACAGGAGGAGATGGGCAAAGG + Intronic
1142493323 17:292713-292735 CTGGAAGAGGAGAGGGCCCAGGG - Intronic
1142631866 17:1230455-1230477 CGCAAAGAGGAGATGGAACGGGG - Intergenic
1143456209 17:7069658-7069680 CGGGAAGAGGAGAGGGGCCAGGG + Intergenic
1143731421 17:8884987-8885009 ATCACAGCGGAGATGGGCCCTGG - Intronic
1144684089 17:17214900-17214922 CCAAAAGAGGAGCTGGGCCGTGG - Intronic
1144968763 17:19094003-19094025 CCCACAGGGCAGATGGGCCAAGG - Exonic
1144979153 17:19158063-19158085 CCCACAGGGCAGATGGGCCAAGG + Exonic
1144989069 17:19220169-19220191 CCCACAGGGCAGATGGGCCAAGG - Exonic
1146945321 17:36869583-36869605 CTGGAAAAGGAGAGGGGCCAGGG + Intergenic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1147166080 17:38594137-38594159 CACAAACAGCAGAGGGGCCAAGG - Intronic
1147370952 17:39992704-39992726 AGCAAACAGGTGATGGGCCAAGG - Intronic
1147839810 17:43363371-43363393 CTCTAAGAGGAGGAGGGCCGTGG - Intergenic
1148389769 17:47263034-47263056 CTCAAAGAGGCACTGGGCCTTGG + Intronic
1148769838 17:50060367-50060389 CTCAAAGAGGAGAAGGCCCCTGG - Intronic
1150418487 17:65007061-65007083 CTCAAAAAGCAGATGGCCCAGGG - Intergenic
1151542562 17:74772055-74772077 CTCGCAGAGGAGATGAGACAGGG + Intronic
1151652915 17:75481188-75481210 CCCAAAGAGGCCATGGTCCAGGG - Intronic
1152318760 17:79596285-79596307 CCCAGAGAGGAAATGGGCCCTGG - Intergenic
1152411270 17:80124537-80124559 CTCAGAGAGGAGCTAGGACAAGG + Intergenic
1155266576 18:24100392-24100414 CTTAAAGAGGTGAAGGGCCAAGG - Intronic
1155632389 18:27908444-27908466 CTGAACATGGAGATGGGCCAGGG - Intergenic
1155894296 18:31304378-31304400 GTGAAAGAGGAGATGGACAAGGG + Intergenic
1157006564 18:43590257-43590279 CCCAAGGAGGAGCTGGGCCAGGG - Intergenic
1157194427 18:45609156-45609178 CTTAAAGAGGAGATGGGAGCAGG - Intronic
1158581794 18:58690515-58690537 CTCACAGAGGGGATGGGCTCCGG - Intronic
1158942513 18:62418626-62418648 CACAAAGGGGTGATGGGCCAAGG - Intergenic
1160026020 18:75216936-75216958 CTCACCGAGGAGGAGGGCCAGGG + Intronic
1160127448 18:76189513-76189535 CTCAAAGAGGAGCTTGCCCAGGG + Intergenic
1161283941 19:3459373-3459395 ATCACAGAGGGGAGGGGCCAGGG - Intronic
1163008257 19:14409586-14409608 CTCCACGAGGAGCTGGGCCAGGG + Exonic
1163893550 19:20037966-20037988 CCCTGAGAGGAGATGGCCCAGGG + Intronic
1165382278 19:35489853-35489875 CTCAAAGAGGAGTGGGGCTGGGG - Intronic
1165830177 19:38726812-38726834 CTCACAGGGGACACGGGCCATGG - Intronic
1166812710 19:45523777-45523799 CTGAAAGAGGAAATGGGCAGAGG + Intronic
1166977233 19:46611855-46611877 CTCACACAGGAGCTGGGCAAGGG + Intergenic
1167035401 19:46992412-46992434 TTCACAGGGGAGATGGGCCAGGG + Intronic
1167493906 19:49806983-49807005 CACAGAGGGGAGAGGGGCCAGGG + Exonic
927461347 2:23301001-23301023 CTCAAAGTGGGGGTGGGCCTAGG + Intergenic
928200023 2:29241903-29241925 CTCTAAGAGGGGATGTGCAAGGG - Intronic
928856927 2:35813711-35813733 GTCAAATGGGAGATGGGCCATGG - Intergenic
929536599 2:42787997-42788019 CTGAAGGAGGAGTTGGGGCAGGG - Intronic
930053398 2:47234341-47234363 TTCACGGAGGAGATGGGCCTTGG + Intergenic
930090353 2:47527311-47527333 TTCACAGGGGAGAGGGGCCATGG + Intronic
930730093 2:54720667-54720689 TTCAAAGAAGAGAAGGGTCATGG - Intergenic
932739231 2:74279151-74279173 CTTAAGGAGAACATGGGCCAAGG - Intronic
933425941 2:82112481-82112503 GTCAGAGAGGAGATCGGCTATGG + Intergenic
933427058 2:82126629-82126651 GTCAAAGAAGAGTTTGGCCAGGG - Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935571055 2:104660547-104660569 CTTAAAGAGGATATGGGGCTTGG - Intergenic
935899466 2:107775293-107775315 CTGAAAGATGAGAAGGGCCCGGG + Intergenic
937273485 2:120670007-120670029 GTCAAAGAGGAGATGTGGGAGGG - Intergenic
938238254 2:129723600-129723622 TACCAAGAGGAGAGGGGCCAAGG + Intergenic
941996427 2:171605775-171605797 GTCAGAGAGGAGTTTGGCCAGGG - Intergenic
944273959 2:197814484-197814506 CTCAAAGAGTAGGAGGCCCAAGG - Intronic
944408739 2:199415697-199415719 ATTAGAGAGGTGATGGGCCACGG - Intronic
944636055 2:201677199-201677221 CTCCCAGAGGAGAAAGGCCAGGG - Intronic
947025516 2:225733693-225733715 CTCACAGAGGAGAGAGGCCGGGG - Intergenic
947814930 2:233030444-233030466 CTTAGAGAGAAGATGGGGCAAGG - Intergenic
948421176 2:237860809-237860831 CCCAGCGAGGAGAGGGGCCAGGG + Intronic
948516267 2:238505653-238505675 CTCAAGGAGGGGGAGGGCCACGG - Intergenic
948806233 2:240454413-240454435 GTCCGAGAGCAGATGGGCCAGGG + Intronic
1169274283 20:4222590-4222612 CTCAGACAGGAGATGTGGCAGGG - Intronic
1169667312 20:8052045-8052067 ATGGAAGAGGAAATGGGCCACGG - Intergenic
1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG + Intronic
1170821305 20:19758056-19758078 CTCGCAGAGGAGATGGGGCGGGG - Intergenic
1170842940 20:19938840-19938862 CTCAAAGAGAGGATTGGCCAAGG - Intronic
1172949836 20:38715806-38715828 CTCTGAGAGGAGCTGGGCCGTGG - Intergenic
1172950054 20:38717394-38717416 CACAAAGAGGTGTTTGGCCACGG + Intergenic
1173689936 20:44952919-44952941 CTAAAAAAGGGGAAGGGCCAGGG - Intronic
1173782512 20:45768333-45768355 GTCAAAGATGGGTTGGGCCAAGG - Intronic
1174118190 20:48242372-48242394 CTCAGAGAGGAGATGAGCAATGG - Intergenic
1174200106 20:48801254-48801276 CTGAAAGAGGAGATGTTCCTTGG - Intronic
1175821582 20:61913040-61913062 CACAAGCAGGAGATGGGCCGAGG - Intronic
1175985054 20:62760474-62760496 TTCAAAGAGGAGATGGGGGAGGG - Exonic
1176270002 20:64231346-64231368 CTCAGAGAGGTCATGGGCCTGGG + Intronic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1178097810 21:29234570-29234592 CTCATAGGGGAGCTTGGCCAGGG - Intronic
1179186853 21:39091488-39091510 CTGAGAGAGGAGAGGGGACAGGG - Intergenic
1179620741 21:42614067-42614089 CTGACAGAGGAGATGGGATAGGG + Intergenic
1179829563 21:43988084-43988106 CTCACCCAGGAGAGGGGCCAAGG + Intergenic
1179898471 21:44376713-44376735 TTCAAAGAGGAGATGGTGAACGG + Intronic
1179985795 21:44919751-44919773 CTGACAGAGGAGAGGGGCCCCGG + Intronic
1180915339 22:19482107-19482129 CACAGAGAGGGGATGGGACATGG + Intronic
1181023086 22:20113570-20113592 AGCAAAGAGGAGCTGGGCCTGGG + Intronic
1182143728 22:27984083-27984105 AGCAGAGTGGAGATGGGCCATGG - Intronic
1182243427 22:28935658-28935680 ATCTAAGAGGAGATGGGAGAAGG - Intronic
1183070590 22:35393445-35393467 CTGAAAGAGAAAATGGGGCAAGG - Intronic
1183508071 22:38220382-38220404 GGCACAGAAGAGATGGGCCAGGG + Exonic
1184633020 22:45800870-45800892 GCCTAAGAGGAGATGGGGCAGGG + Intronic
1184686001 22:46096654-46096676 ATCAAAGAGGAGAGTGGCCCCGG + Intronic
1184856648 22:47150019-47150041 CACCAGGAGCAGATGGGCCAGGG + Intronic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
949343667 3:3056053-3056075 TTCAAAGGGAAGAGGGGCCACGG - Intronic
949573426 3:5315280-5315302 CCAGAAGAGGAGTTGGGCCAGGG - Intergenic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
952109759 3:30109033-30109055 GTCAGAGAGGAGTTCGGCCAGGG + Intergenic
954451879 3:50576124-50576146 CTTTTGGAGGAGATGGGCCATGG - Intronic
955340701 3:58123084-58123106 CTCAAATAGGTGAAGGCCCACGG + Exonic
958181534 3:90066633-90066655 CCCAAAGGGGACATGGGCCTTGG + Intergenic
958815321 3:98907874-98907896 TTCAGAGAGGAGATGGGGCCAGG + Intergenic
959487073 3:106939089-106939111 AGCAAAGATGAGATGGGGCAAGG - Intergenic
959773981 3:110134780-110134802 GTCAGAGAGGAGATTGGCCATGG + Intergenic
961036231 3:123643872-123643894 CACAAACATGAGATGAGCCATGG + Intronic
961820293 3:129572460-129572482 CTCAGAGAGGAGAAGGGGCTTGG + Intronic
967074876 3:185993150-185993172 CCAAAAGCTGAGATGGGCCAAGG + Intergenic
968041247 3:195591114-195591136 CTCAGCTGGGAGATGGGCCAGGG + Intergenic
968094220 3:195916676-195916698 CTGAAGGAGGAGATGGGTAAAGG - Intergenic
969073301 4:4557162-4557184 CTCAAAGAGGACAGGACCCAGGG - Intergenic
971194265 4:24456980-24457002 AGCAAAGAGGACATGAGCCAAGG + Intergenic
972693800 4:41425024-41425046 ATAAAGGAGGAGATGGACCAGGG - Intronic
974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG + Intergenic
975645414 4:76541485-76541507 TTCAAAGAGGGGATGGACCAGGG - Intronic
978012063 4:103699723-103699745 ATGAAAGATGAGATGAGCCAAGG + Intronic
981362761 4:143866490-143866512 GTCAGAGAGGAGATAGGCCATGG + Intergenic
981382596 4:144090561-144090583 GTCAGAGAGAAGATAGGCCATGG + Intergenic
985277569 4:188252727-188252749 CTTCAACAGGAGCTGGGCCACGG - Intergenic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
985631380 5:1015841-1015863 GTCCAACAGGAGAGGGGCCACGG - Intronic
986334917 5:6747251-6747273 CACACAGAGGAGAAGGCCCAGGG - Intronic
986492901 5:8310242-8310264 CTTAAAGAGGAGATAGGAAAAGG + Intergenic
987113725 5:14710870-14710892 TTCCAAGAGGAGATTGTCCAGGG + Exonic
987932139 5:24415140-24415162 GTTAGAGAGGAGATCGGCCACGG - Intergenic
991468302 5:66938520-66938542 TTTAAAGAGGAGTTGGGCAAAGG + Intronic
991504161 5:67306682-67306704 CTCAAACAGGAGATAGCACATGG + Intergenic
992027611 5:72686031-72686053 CACACACAGGAGAAGGGCCATGG + Intergenic
993773532 5:91962442-91962464 GTCAGAGAGGAGATTGGCCATGG + Intergenic
994793097 5:104257597-104257619 TTCACAGTTGAGATGGGCCATGG + Intergenic
995121119 5:108536144-108536166 CTCAGAGAAGAGTTGGGCCAGGG + Intergenic
998188159 5:139998945-139998967 CTGAAAGAGGTGGTGGGGCAAGG - Intronic
999503971 5:152176365-152176387 ATCAAAGAGTAGATCGGCCCAGG - Intergenic
1000184219 5:158843403-158843425 CTCAAAGATGAGCTGGGGCAGGG + Intronic
1002212527 5:177607393-177607415 CTCAACGAGGAGCTGGACTATGG + Exonic
1003238647 6:4322069-4322091 CACAAAGAGGGAATGGGACAGGG - Intergenic
1003448222 6:6204928-6204950 CTCAGAGAGGACAGGGGCCCTGG - Intronic
1006305314 6:33215065-33215087 CTCACAGAGGAGGTGGGACTGGG + Intergenic
1008380062 6:50831383-50831405 AGCTAAGAGGAGAGGGGCCACGG - Intronic
1011491844 6:87900813-87900835 GTCAGAGAGGAGATAGGCCATGG - Intergenic
1011494279 6:87923224-87923246 ATGGAAGAGGAGGTGGGCCAGGG - Intergenic
1011657568 6:89565610-89565632 TTCAAACAGGATATGGTCCAGGG + Intronic
1015956785 6:138607041-138607063 CTCAAAGAGGAGGTGCCCCCAGG + Intronic
1016888548 6:148982450-148982472 CTTTAAGAGGTGAAGGGCCATGG - Intronic
1017676873 6:156823224-156823246 CTCAATGAGTAGGTGGGCCCTGG + Intronic
1019217879 6:170455192-170455214 CTCACAGAGGACATGCCCCAGGG - Intergenic
1019994056 7:4711907-4711929 CTCAAGGTTGAGATGGGGCAGGG + Intronic
1020389890 7:7646730-7646752 GTCAGAGAGGAGATTGGCCATGG - Intronic
1021867305 7:24971072-24971094 CTCAAAGAGGCAGTGGCCCAAGG + Intronic
1023058417 7:36308003-36308025 CTAGAATAGGAGCTGGGCCAGGG + Intergenic
1023248407 7:38231951-38231973 CTCATAGTGGAGAAGGGGCAAGG + Intergenic
1023520542 7:41046208-41046230 CTCTAAGAGGAGGAGGGCAATGG + Intergenic
1023754325 7:43402005-43402027 GTCGAAGAGGAGATTGGCCGAGG + Intronic
1027053205 7:75032512-75032534 CTCAGAGAGGAGAAGGGGAAGGG - Intronic
1028520281 7:91722225-91722247 CCAAAAGAAGAGATGGGCAAAGG + Intronic
1030386163 7:108870635-108870657 TTCAGAGAGGAGTTTGGCCAGGG - Intergenic
1032097888 7:128948544-128948566 GGCAAAGAGGAGATGAGACAGGG - Intronic
1033431890 7:141296792-141296814 ATAAAAGAGGAGATGGGAGACGG - Intronic
1033531289 7:142266511-142266533 CTGAAAGATGAGAAGGGCAATGG + Intergenic
1034229009 7:149505218-149505240 CTAAAAGAGAATATGGGACATGG + Intergenic
1034846828 7:154454197-154454219 CTCACAGAGCAGATGCCCCAGGG - Intronic
1036735797 8:11314985-11315007 CTCTAAGATGATCTGGGCCAAGG - Exonic
1037289506 8:17336163-17336185 CTGAAAAAGGAGATGCGCCTTGG + Intronic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1038670695 8:29580728-29580750 CTCAAAGGAAAGATGGTCCATGG - Intergenic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039039682 8:33395399-33395421 GTCAGAGAGGAGTTCGGCCAGGG + Intronic
1039290451 8:36088925-36088947 GTCAGAGAGGAGTTTGGCCAGGG - Intergenic
1039557905 8:38489922-38489944 CTCAAAGAGGCTATGGGGCCAGG - Intergenic
1040516937 8:48143295-48143317 CTGGAAGCGGAGATGGGCCATGG + Intergenic
1041872855 8:62654865-62654887 CTCAAATAAGAGAGAGGCCATGG + Intronic
1042147280 8:65743291-65743313 TTCAAAAAGGAGAAGGGCCAAGG + Intronic
1042276287 8:67008412-67008434 TTTAAAGAGGATTTGGGCCATGG + Intronic
1042514470 8:69644976-69644998 CTCAAACAAGAGATGGAGCAGGG + Intronic
1046479560 8:114797847-114797869 CTAAAAGAGGAGGAGGGGCAGGG + Intergenic
1047497356 8:125418008-125418030 CTGAAAGATGAAGTGGGCCAGGG - Intergenic
1047500068 8:125433417-125433439 CTCAAAGAAGACATAGGCCTTGG - Exonic
1047685988 8:127305098-127305120 CTGAAAGAGGAGATTTGGCAAGG + Intergenic
1047927495 8:129695778-129695800 TTGAGAGAGGAGTTGGGCCATGG + Intergenic
1051249184 9:15142062-15142084 CTCAAAGAGCATATGGGCTGTGG + Intergenic
1052223683 9:26058266-26058288 CTCAAAGAGGCTGTGGTCCAAGG + Intergenic
1053753680 9:41280695-41280717 GTCACAGGGGAGATGGGCAAAGG + Intergenic
1054259203 9:62845055-62845077 GTCACAGGGGAGATGGGCAAAGG + Intergenic
1054332577 9:63774982-63775004 GTCACAGGGGAGATGGGCAAAGG - Intergenic
1055485917 9:76756375-76756397 TTCAAAGAGGAGAGCTGCCAGGG - Intronic
1057867483 9:98692964-98692986 CTCAAAGAAGAGATGGGGGTAGG + Intronic
1058983928 9:110194888-110194910 CTCAGAGAGGGGTTGGGTCATGG - Intronic
1059123079 9:111660229-111660251 TTCAAAGAGTAATTGGGCCAGGG + Intronic
1059374150 9:113869273-113869295 CTCAGAATGGAGATGGGCCCAGG - Intergenic
1059514750 9:114882735-114882757 AACAAACTGGAGATGGGCCATGG + Intergenic
1061175980 9:128997410-128997432 CTCAAAGAGGAGGTGAACCTGGG + Intronic
1061415926 9:130446718-130446740 GCCAAAGATGAGATGGGCCCGGG - Intronic
1061590415 9:131594250-131594272 CTCAAAGACCAGGTGAGCCAGGG - Intronic
1061925984 9:133806276-133806298 CTCAAGGAGGGGAGGGGCCCGGG + Intronic
1062041426 9:134405970-134405992 TTCCTGGAGGAGATGGGCCAGGG - Intronic
1062467956 9:136689540-136689562 ATCCAAGAGGAGGCGGGCCAGGG + Intergenic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1185861476 X:3583435-3583457 CTAATAGAGCAGATGGGACAGGG - Intergenic
1185909063 X:3965687-3965709 GTCGGAGAGGAGATAGGCCATGG + Intergenic
1186031735 X:5376067-5376089 GTCAGAGAGGAGATGGGCCATGG + Intergenic
1186039241 X:5457793-5457815 GTCAGAGAGGTGATTGGCCATGG - Intergenic
1186096218 X:6105309-6105331 TCTAAAGAGGAGATAGGCCAAGG - Intronic
1186281418 X:7997150-7997172 TTCCAAGAGGACAGGGGCCAAGG - Intergenic
1187007716 X:15248751-15248773 CTCCAAGAAGAGCTGGGCCAAGG + Exonic
1188437550 X:30179603-30179625 GTCAGAGAGGAGATCGGCCACGG + Intergenic
1188561898 X:31478136-31478158 GTCAATGAGGAGATCGCCCACGG + Exonic
1189134483 X:38534324-38534346 CTCAAAGAGGAGGTGGGCACAGG + Intronic
1189201285 X:39197710-39197732 CTGAAACTGGAGGTGGGCCAAGG + Intergenic
1193467917 X:81869392-81869414 CCCAAGGTGGAGCTGGGCCAGGG - Intergenic
1196649771 X:118156927-118156949 CTCAGAGAGGAACTAGGCCAGGG + Intergenic
1197287887 X:124617436-124617458 CACAAAGAGGAAAGGGGGCAGGG + Intronic
1197800551 X:130343251-130343273 CTCAAAGAGGGGATATGCCATGG + Intronic
1197971424 X:132119094-132119116 CTCAAAGAGATCATGGGCTAGGG - Intronic
1200375984 X:155780758-155780780 CCCAAAGAGGAGAAGGCCCCAGG + Exonic
1200803053 Y:7403849-7403871 CTAATAGAGCAGATGGGACAGGG + Intergenic