ID: 1038259263

View in Genome Browser
Species Human (GRCh38)
Location 8:25978992-25979014
Sequence CCTCCGTGTCACAAGATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038259263_1038259269 23 Left 1038259263 8:25978992-25979014 CCCTTAATCTTGTGACACGGAGG 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1038259269 8:25979038-25979060 CTGAACACACACCCTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038259263 Original CRISPR CCTCCGTGTCACAAGATTAA GGG (reversed) Intronic
903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG + Intronic
908337642 1:63143929-63143951 CCTCTTTGTCACATCATTAAAGG + Intergenic
909346162 1:74590021-74590043 CCTCACTGTCACTAGAATAAGGG + Exonic
912104445 1:106253929-106253951 CCTCTGTCTCACAATATTGAAGG - Intergenic
917321847 1:173790680-173790702 CCTCCGTGTCCCAGGTTCAAGGG - Intergenic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
919147844 1:193657555-193657577 CCTCAGTGTCACAAGAAGTAAGG + Intergenic
1064611889 10:17112317-17112339 CCTCTGTGTGATAAGATCAAAGG + Intronic
1069323397 10:67201711-67201733 CCTCCATTTCACATGTTTAAAGG + Intronic
1069963196 10:72091015-72091037 CCTCCGCCTCCCAAGTTTAAGGG + Intergenic
1073233626 10:101994344-101994366 CCTCCTTTTCACAAGATTAGGGG - Intronic
1080416255 11:32072583-32072605 CGGCCGAGTCACAAGATTCAAGG + Intronic
1083555201 11:63620588-63620610 CCTCCTTATCACAAGAGGAATGG - Intergenic
1088646461 11:111920452-111920474 CCTCTGTCTCCCAAGCTTAAGGG - Intronic
1118611592 14:67545188-67545210 CCTCCGAGTCACTAACTTAAAGG - Intronic
1119652999 14:76396960-76396982 CCGCAGAGACACAAGATTAATGG - Intronic
1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG + Intergenic
1120726409 14:87946731-87946753 CCTGTGTTTCACAAAATTAATGG + Intronic
1128986775 15:72227944-72227966 CATCAGTGTCACAACATTCAAGG + Intronic
1129928595 15:79388394-79388416 TCTCCTTGTCAACAGATTAAGGG - Intronic
1141300659 16:82812588-82812610 CCTCCGTGTCACTAGATGCAGGG - Intronic
1149324253 17:55513659-55513681 CCTCCATGTAACAATATTTAGGG + Intergenic
1149467882 17:56893855-56893877 ACTCCGTGTCACAAAATCCAGGG - Intronic
1151515843 17:74594968-74594990 CTGCCGTGTCAAAAGATTAGGGG - Intergenic
1152367940 17:79867831-79867853 TCTCTGTGTCATAAGATTATAGG - Intergenic
1158010322 18:52720730-52720752 GCTCTGTGTCACAAGTTAAATGG - Intronic
1164050062 19:21578173-21578195 CCTCCGCCTCCCAAGTTTAAGGG + Intergenic
927444148 2:23142882-23142904 CCTCCTTCTCCCAAGATAAAGGG + Intergenic
931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG + Intergenic
932414441 2:71565162-71565184 CCTCCGCCTCACAAGTTCAAGGG + Intronic
933518109 2:83331713-83331735 CCTTCTTGTCAAAATATTAATGG - Intergenic
935434643 2:103016349-103016371 ACTCAGTGTCACATAATTAAGGG - Intergenic
938100402 2:128494073-128494095 CTGCGGTGTCAGAAGATTAAGGG - Intergenic
941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG + Intronic
942853865 2:180523054-180523076 CCTCCCTGACACAACACTAATGG + Intergenic
944006843 2:194920014-194920036 CTCCCGTCTCACAAGATAAAAGG + Intergenic
945940000 2:215939334-215939356 CCACCTGGTCACAAGATTATGGG - Intergenic
1175047540 20:56121346-56121368 CCTCTGTGTTACAAAATCAAGGG - Intergenic
951168531 3:19510885-19510907 CCTCTGTGTCACAGGATTATTGG - Intronic
959332151 3:105020107-105020129 CCTGAGTATCACAAGATTAAGGG - Intergenic
961051023 3:123747241-123747263 ACCCCCTGTCACAAGATTTAAGG - Intronic
966732867 3:183164745-183164767 CCTCCTTATCACTAGATTGAGGG + Intergenic
966927206 3:184652514-184652536 TCTCCCTGTCACCAGACTAATGG + Intronic
979608210 4:122661859-122661881 CCTACGTGTCACTAGATAAGGGG + Intergenic
980784085 4:137530276-137530298 CTTTCATGTCACAAGAATAAGGG - Exonic
984183870 4:176518654-176518676 CCTCAGTGTCCCAAGAGAAATGG + Intergenic
1003166157 6:3680189-3680211 CCTCCGTGTCACCAGTTGAGAGG + Intergenic
1007566042 6:42851099-42851121 CCTCCGTCTCCCAAGTTCAATGG - Intronic
1014728442 6:125002334-125002356 CCTCCTCGTCACAAGCTTCATGG + Intronic
1025218533 7:57082659-57082681 ACTCAGTCTGACAAGATTAAAGG - Intergenic
1025629457 7:63256276-63256298 ACTCAGTCTGACAAGATTAAAGG - Intergenic
1025652814 7:63487803-63487825 ACTCAGTCTGACAAGATTAAAGG + Intergenic
1031390973 7:121214374-121214396 CCTCCGCCTCACAAGATCAAGGG + Intronic
1035938669 8:3871655-3871677 CCTCTGTATGAAAAGATTAAAGG - Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037728010 8:21499683-21499705 CGTCCGTGGCACAAAATAAAAGG + Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1047340398 8:123975271-123975293 CCTCGGTGTCAGAAGTTTTAGGG - Exonic
1052606200 9:30705250-30705272 CCTCAGGATCAAAAGATTAAAGG - Intergenic
1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG + Intronic
1061664993 9:132155450-132155472 GCTCCGTGTCAGAAGAGTAATGG - Intergenic
1187138924 X:16574982-16575004 TTTTCCTGTCACAAGATTAATGG - Intergenic
1188369946 X:29357713-29357735 CCTCCGTGTCATAAGGTTCTTGG + Intronic
1192358565 X:70424737-70424759 TCTCCAGGTAACAAGATTAAAGG + Intronic