ID: 1038259269

View in Genome Browser
Species Human (GRCh38)
Location 8:25979038-25979060
Sequence CTGAACACACACCCTTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038259267_1038259269 -5 Left 1038259267 8:25979020-25979042 CCGAATACCGTAGCTCATCTGAA 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1038259269 8:25979038-25979060 CTGAACACACACCCTTGTGAAGG No data
1038259265_1038259269 22 Left 1038259265 8:25978993-25979015 CCTTAATCTTGTGACACGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1038259269 8:25979038-25979060 CTGAACACACACCCTTGTGAAGG No data
1038259263_1038259269 23 Left 1038259263 8:25978992-25979014 CCCTTAATCTTGTGACACGGAGG 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1038259269 8:25979038-25979060 CTGAACACACACCCTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038259269 Original CRISPR CTGAACACACACCCTTGTGA AGG Intronic
No off target data available for this crispr