ID: 1038259272 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:25979058-25979080 |
Sequence | AGGATCCACATAGAAAATGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1038259267_1038259272 | 15 | Left | 1038259267 | 8:25979020-25979042 | CCGAATACCGTAGCTCATCTGAA | No data | ||
Right | 1038259272 | 8:25979058-25979080 | AGGATCCACATAGAAAATGATGG | No data | ||||
1038259268_1038259272 | 8 | Left | 1038259268 | 8:25979027-25979049 | CCGTAGCTCATCTGAACACACAC | No data | ||
Right | 1038259272 | 8:25979058-25979080 | AGGATCCACATAGAAAATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1038259272 | Original CRISPR | AGGATCCACATAGAAAATGA TGG | Intronic | ||