ID: 1038259600

View in Genome Browser
Species Human (GRCh38)
Location 8:25981296-25981318
Sequence CAGTGCTAGGTGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038259600_1038259604 28 Left 1038259600 8:25981296-25981318 CCATCTTCCCTCACCTAGCACTG 0: 1
1: 0
2: 3
3: 29
4: 344
Right 1038259604 8:25981347-25981369 GATTCCTGTCAATTGTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038259600 Original CRISPR CAGTGCTAGGTGAGGGAAGA TGG (reversed) Intronic
902188579 1:14744069-14744091 CATTGCTTGTTGAGGGGAGACGG + Intronic
902882413 1:19381341-19381363 CAGTCGAGGGTGAGGGAAGAAGG - Intronic
903783625 1:25840592-25840614 AAGTTCAAGGTGAGGGAATAAGG - Intronic
903974673 1:27141699-27141721 CAGTGCTCAGTCAGGGAAGCGGG + Intronic
904755867 1:32768261-32768283 CAGTGCTAGGTGATGCTGGAGGG + Intronic
905208750 1:36358762-36358784 CAGTGTTTGGCGAGGAAAGATGG - Exonic
906060716 1:42946725-42946747 CAGTGCTAGGTGTAGGGGGAGGG + Intronic
906372191 1:45263623-45263645 CATGGCTGGTTGAGGGAAGAAGG - Intronic
906468698 1:46108715-46108737 CTGTGCTAGCTCAGGGAAGGAGG - Intronic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
907924872 1:58946021-58946043 GACTGCTAGATGAGGGAGGAAGG - Intergenic
908262378 1:62349325-62349347 CACTGCTAAGTGAGAGAGGAGGG + Intergenic
912865780 1:113255057-113255079 CAGTGGTAGGTGAGGTGAAATGG - Intergenic
912909907 1:113747761-113747783 CAGTGGAAGGTGAGGGACAATGG - Intronic
913018579 1:114764227-114764249 CTCTGCTAGGGGAGTGAAGAAGG + Intergenic
913257300 1:116965083-116965105 GGGTGCTAGGTGAGGCCAGAAGG - Intronic
915213520 1:154326210-154326232 CTGTCCTTGGTGAGGGAAGGTGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917238134 1:172916902-172916924 CAGTGATGGGTGATGGAAGATGG - Intergenic
919600908 1:199621266-199621288 CTGGGCTAGGTCAGGGAAAAGGG - Intergenic
919628719 1:199938296-199938318 CATAGCTAAGTGAGGGAAAACGG - Intergenic
920125420 1:203690508-203690530 GAGGACTAGGTGAGTGAAGATGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
922987720 1:229878991-229879013 CATGGCGATGTGAGGGAAGAAGG + Intergenic
924009049 1:239644343-239644365 CAGAGCCAGGGGTGGGAAGACGG - Intronic
924219488 1:241858049-241858071 CAGTGATAAATGAGGGAATAGGG + Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1063654082 10:7969784-7969806 CAGTGCTGGCTGAGGGAGCATGG + Intronic
1063742907 10:8844372-8844394 CAGTCCTACCTGAGTGAAGAAGG + Intergenic
1064300334 10:14117599-14117621 CATTGCTAGGTGAAGGCTGAAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1067467940 10:46515144-46515166 CAATGCCAGTTGAGGGAGGAAGG - Intergenic
1067535204 10:47104416-47104438 CAGTGCTAGATGAAGGGAGAGGG + Intergenic
1068931058 10:62590754-62590776 CAGTGACAGTTGAGGGAACAAGG - Intronic
1070560931 10:77566080-77566102 CAGTGATAGGCAAGGAAAGATGG + Intronic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1073988181 10:109233031-109233053 TACTGCACGGTGAGGGAAGAGGG + Intergenic
1074683123 10:115930874-115930896 AAGTGCTAACTGAGAGAAGATGG - Intronic
1074898388 10:117796200-117796222 CAGTGCTGGGGAAGGGATGAGGG + Intergenic
1075643692 10:124084077-124084099 CAGAGCTAGGGAAGGAAAGACGG + Intronic
1075708573 10:124518136-124518158 GAGTGCGAGGTGAGTGAGGAAGG + Intronic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076659419 10:132045418-132045440 CTGTGCCAGGTGCGGGTAGAGGG - Intergenic
1077395708 11:2320090-2320112 CAGTGCTAGTGGAGGGGAGTGGG + Intergenic
1077675359 11:4189903-4189925 CAGGCCTAGGTGAGGCAGGAAGG + Intergenic
1078452809 11:11453028-11453050 CAGGGCTGGGTGAGGGCAGGGGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1079001851 11:16764336-16764358 CACACCTAGGTGAGGGAAGGTGG + Intergenic
1079025597 11:16945508-16945530 TAGTGCTTGGTAAGGGATGATGG + Intronic
1079375263 11:19886729-19886751 CAGTCCCAGATGATGGAAGAAGG + Intronic
1079451321 11:20601773-20601795 CAGTGCCAGGTGATGGATGCGGG + Intronic
1081622651 11:44628135-44628157 CAGTGCCTGGTGGTGGAAGATGG - Intergenic
1082807186 11:57458710-57458732 GAGCCCTGGGTGAGGGAAGACGG + Intergenic
1082958280 11:58895137-58895159 AAGTGCTACGTAAGGGAAGCTGG - Intronic
1083896647 11:65623440-65623462 CACTGGAAGGTGAGGCAAGACGG + Intronic
1085008315 11:73115282-73115304 CAGTGCCAGGGTATGGAAGAGGG + Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085562646 11:77486571-77486593 CACTGCCAGGGGATGGAAGAGGG - Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1087448448 11:98285832-98285854 CAGGGCAAGGTGAAGAAAGAAGG + Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1089297554 11:117479204-117479226 CCGTGCTAAGTGGGAGAAGAAGG + Intronic
1089607062 11:119647577-119647599 AGGAGCTAGGAGAGGGAAGAGGG - Intronic
1089641685 11:119851816-119851838 CAGTGCAAGCTGAGAGAACAGGG - Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1090951041 11:131473628-131473650 CTGAGCTAGGAGAGGGAAAATGG + Intronic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096609026 12:52789020-52789042 CAGTGCTAGGTGCAGGAATGGGG + Intergenic
1096749243 12:53748267-53748289 GAGGGCTTGGAGAGGGAAGAGGG - Intergenic
1099425969 12:82523010-82523032 CAGTGCTAGGTCAGGTGAGAGGG - Intergenic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1103325100 12:120115264-120115286 CAGAGCTAGGTCAGGGAAGTGGG - Intronic
1103700285 12:122845649-122845671 GACTGCTGGGTGAGGGGAGAGGG + Intronic
1104723554 12:131060706-131060728 TACTGATACGTGAGGGAAGATGG - Intronic
1105303750 13:19155478-19155500 CACTGCTAGGTGGAGGAGGAGGG + Intergenic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1106023325 13:25934793-25934815 CACTGCCAGCTGAGTGAAGACGG + Intronic
1106159142 13:27185025-27185047 CAAGGCTATGTGAGGGAAGAGGG + Intergenic
1106566114 13:30886081-30886103 CAAAGCAAGGTGAGGGTAGAAGG - Intergenic
1106647442 13:31651505-31651527 CAGGGCCATGTGAGGGAAGAGGG - Intergenic
1106874879 13:34060687-34060709 CAGTTCAGGGGGAGGGAAGAAGG - Intergenic
1107187976 13:37546622-37546644 CCCTGCTTGGTGAGGGGAGAAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113871553 13:113562924-113562946 CAGGGCTAGGTCAGCGAAGAAGG + Intergenic
1114398060 14:22384499-22384521 CAGTGGTAGGTAGAGGAAGAAGG + Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1119197771 14:72730185-72730207 CAGTGGTGGGTGCGGGGAGAGGG + Intronic
1119919431 14:78432672-78432694 AAGAGGAAGGTGAGGGAAGAAGG - Intronic
1120630261 14:86881810-86881832 CATTTCAAGGTGAAGGAAGATGG + Intergenic
1121375813 14:93410092-93410114 CACTGCTAGGTGAGGGAGGAAGG - Intronic
1122986390 14:105213627-105213649 CAGTGCCAGGTGGGGGAGGGAGG - Intronic
1124532530 15:30520120-30520142 TAGTGCTGGGTAAGGCAAGAAGG - Intergenic
1124766123 15:32487524-32487546 TAGTGCTGGGTAAGGCAAGAAGG + Intergenic
1124796141 15:32782229-32782251 CAGTGCTGGGTAAAGGAACAAGG - Intronic
1128818183 15:70629551-70629573 CAGGGCTAGGGCAGGGAGGAGGG - Intergenic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129317120 15:74751732-74751754 TAGTGTAAGGTGAGGAAAGAAGG - Intronic
1131529452 15:93179450-93179472 GGATGCTAGGTGAGGGACGAGGG - Intergenic
1133023583 16:2977732-2977754 CAGTGCTAGGCGGGGGGAGAGGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1137415064 16:48268740-48268762 GAGTCCTAGGTGAGTGAAGTAGG - Intronic
1137500932 16:49011149-49011171 CAGAGGTTGGTGGGGGAAGAGGG + Intergenic
1139468530 16:67166480-67166502 CACTTCCAGGTGAGGGAGGAAGG - Intronic
1140335436 16:74100556-74100578 CAGGGCTGGGTGCAGGAAGAGGG + Intergenic
1141005109 16:80344701-80344723 CCGTGCTAGGAGAGGGTAGGAGG + Intergenic
1141389067 16:83649394-83649416 CAGTGGGAGGTGAGGAAATACGG + Intronic
1141692478 16:85604172-85604194 TAGGGCTAGGGGAGGGGAGAGGG - Intergenic
1142261552 16:89044838-89044860 TGGTCCAAGGTGAGGGAAGAGGG + Intergenic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1144300449 17:13918921-13918943 CATTCCTAGTTGAGGGAAGGGGG - Intergenic
1144334709 17:14258299-14258321 CAGAGCAAGGTAAGGGAGGATGG - Intergenic
1145787171 17:27601678-27601700 CACTGCTAGGAGATGGCAGAAGG + Intronic
1145914552 17:28563960-28563982 CAGTGTTAGGTCTGGGAAGGTGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146693293 17:34891168-34891190 TAGCGCTGGATGAGGGAAGATGG - Intergenic
1146712841 17:35057321-35057343 CAGAGCAAGGTGAGTGAAGTGGG - Intronic
1146809338 17:35890757-35890779 CAGTGCAAGGTGACAGAAGAGGG - Intergenic
1147652565 17:42070909-42070931 CAGTGCTGGGAGAGGGCAGTGGG - Intergenic
1148977636 17:51543680-51543702 CAGTGCTTGGTGACAGAAGCTGG - Intergenic
1150505898 17:65698880-65698902 CAGTGCAAGCCCAGGGAAGAGGG + Intronic
1150847806 17:68677226-68677248 TAGTGCCAGGTTTGGGAAGAGGG - Intergenic
1151335609 17:73437950-73437972 CAGTGCTGGGTGAGAGAGGGTGG - Exonic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151575478 17:74950832-74950854 CAGAGCTGGGTGAAGGATGAGGG + Exonic
1152276080 17:79358314-79358336 CAGTGCTGGGGAGGGGAAGACGG - Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1153910928 18:9706414-9706436 CAGAACTAGGGGAGGGGAGAAGG + Intergenic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1154332237 18:13439709-13439731 CAGGGCTGGGTGCAGGAAGAGGG + Intronic
1157320173 18:46628289-46628311 CAGTGCTAGGTGGGAGCAGATGG + Intronic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157606832 18:48931150-48931172 AAGTGCTGGGGGAGGGGAGAAGG + Intronic
1157652204 18:49344967-49344989 GAGTGCCAGGTTAGGGTAGAAGG + Intronic
1157686080 18:49643954-49643976 CAGAGCTGGGGGAGGGAAAATGG - Intergenic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160353089 18:78201682-78201704 CAATGGTAGGTGAGCGAAGAGGG - Intergenic
1161115770 19:2495656-2495678 CAGGGCCAGGTGTGGGCAGAGGG - Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161646508 19:5456467-5456489 CAGTGGTAGGTGTGGGAGCAGGG - Exonic
1161759436 19:6160451-6160473 CCGTGCTAGGTATGGGTAGAGGG + Intronic
1164814099 19:31181177-31181199 CACTGCAAGATGAGGGAAGTTGG - Intergenic
1165074355 19:33272670-33272692 CAGTGCTAGGATAGGGATGTAGG - Intergenic
1165719576 19:38069528-38069550 CAGTCTTAGGTGAGGACAGAAGG - Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167795858 19:51708064-51708086 CAGTCCTTGGGGAGGGAAAAAGG - Intergenic
1168146154 19:54420932-54420954 CAGTCCTAGGGAGGGGAAGACGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925380261 2:3419900-3419922 CACTGCTAGGGAAGGCAAGATGG + Intronic
926224887 2:10960776-10960798 CAGGGCTGGGTGAGGGGAGGTGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927926816 2:27019331-27019353 GAGTGCTGGGGGAGGGAGGATGG + Intronic
927972505 2:27314769-27314791 CAGTGCTAATTGAGGGCACAGGG - Intronic
928260087 2:29758632-29758654 CAGTGCCTGGGGAGGGAGGAGGG - Intronic
931514604 2:63040681-63040703 CACTGCTGGTTGAGGGAAAAAGG + Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932176430 2:69607127-69607149 GAGTGTTATGTGGGGGAAGAGGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932356334 2:71071386-71071408 CGGGGCAAGGTGAGGGGAGATGG - Intronic
932422208 2:71607947-71607969 CAGGGCTTGGTGGAGGAAGATGG + Intronic
937049463 2:118876479-118876501 CAGGGCTGGGTCAGGGGAGATGG - Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937238468 2:120444884-120444906 CAGTGCTAGGTGTTGGCAGGAGG + Intergenic
937782142 2:125850711-125850733 CATTGCCAGTTGAGGGTAGAGGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939685936 2:145200228-145200250 CAGTGCTGGGCGGGGGTAGACGG + Intergenic
941142562 2:161803634-161803656 TATTGCTAGGTGAAAGAAGATGG - Intronic
948500801 2:238392384-238392406 GAGTTCGAGGTGGGGGAAGAGGG - Intronic
948627255 2:239276770-239276792 CAGAGCCAGGCGAGGCAAGACGG + Intronic
1169073612 20:2748965-2748987 CAGTGCAGGGCGGGGGAAGAAGG + Intronic
1169143119 20:3237207-3237229 CAGGGCTGGGTGAGGACAGAGGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1171212560 20:23328003-23328025 CAGTGCAACGCAAGGGAAGAGGG + Intergenic
1172304389 20:33871018-33871040 CAAGGCCAAGTGAGGGAAGAGGG - Intergenic
1172573224 20:35986590-35986612 CAGTGCCATGTCAGGGACGAAGG - Intronic
1172818629 20:37711835-37711857 CAGAGCTTGGTGAGTGAAGAGGG + Intronic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1174160445 20:48546653-48546675 CGGTGCTCTGTGATGGAAGAGGG + Intergenic
1174543619 20:51308496-51308518 CAGGTCCAGGGGAGGGAAGAAGG + Intergenic
1175324654 20:58114829-58114851 CAGTGCTAGGTTTAGGATGAGGG - Intergenic
1175828828 20:61951115-61951137 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175828847 20:61951150-61951172 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1176094819 20:63335767-63335789 CAGAGCCAGGTGAGGGAAAGAGG - Intergenic
1176943804 21:14954827-14954849 TATTTCTTGGTGAGGGAAGAGGG + Intergenic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1179030401 21:37714975-37714997 CAGAGGTACGTGAGGAAAGACGG - Exonic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179709865 21:43207105-43207127 CGCTGAAAGGTGAGGGAAGAAGG - Intergenic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180682621 22:17638878-17638900 CAGGGCCAGGTGAGGGGAGTGGG + Exonic
1181052448 22:20244283-20244305 CAGTTCTAGGTTGGGGAAGCTGG - Intronic
1181262376 22:21607606-21607628 CAGACCTGGGTGAGGGAAAAGGG + Intronic
1181380253 22:22496677-22496699 AAGTGATAGGCAAGGGAAGATGG + Intronic
1181776931 22:25166519-25166541 CAGGGCTGAGTGATGGAAGAAGG - Intronic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1182624753 22:31637784-31637806 CAGTGCCGGGTGAGGGGAGCGGG - Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1184512256 22:44940585-44940607 CAGTGCTGGGTGGGGAAGGATGG + Intronic
1184586730 22:45452924-45452946 CAGTTCTAGCTGAGGGATGGTGG - Intergenic
1184857370 22:47153738-47153760 CAGGGCAAGGTCAGAGAAGAAGG + Intronic
1185054788 22:48573979-48574001 CTGTGCCAGGTGAGGGATGAAGG + Intronic
949592447 3:5508640-5508662 CAGTGATAAGTGAGGGGTGATGG + Intergenic
954419842 3:50412989-50413011 TCGTGCCAGGTGAGGGAAGATGG - Intronic
954476381 3:50750208-50750230 CAGGGCCAGGTCAGGGATGAGGG - Intronic
954919095 3:54174355-54174377 CTTTGCTAGGTGAGGGGAGACGG + Intronic
956160352 3:66345238-66345260 CAATGCTAGGGGAGTGGAGAGGG - Intronic
956278549 3:67530191-67530213 CACAGCTGGGTGAGGGATGAAGG - Intronic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
958921737 3:100114297-100114319 CACTGCCCGGAGAGGGAAGAGGG - Exonic
960122198 3:113958345-113958367 CCGAGCTAGGAGAGGGAAAAAGG - Exonic
961470811 3:127110380-127110402 CAGAGATGGGTGAGGGAAGAAGG + Intergenic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
962246719 3:133801545-133801567 CAGAGCTATGTGAATGAAGAGGG - Intronic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962576934 3:136763495-136763517 CAGTGCTAGGGCAGTGCAGAAGG + Intergenic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
966877711 3:184332821-184332843 CAGTCCTAAGTGAGGCAAGATGG + Intronic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
967612730 3:191526911-191526933 TTGTTCTAGGTGAGGGACGAGGG - Intergenic
967739576 3:192990134-192990156 CAGGGGTCGGTGGGGGAAGATGG + Intergenic
967904986 3:194491894-194491916 TAGTGCCAGGTGAGAGATGAGGG - Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
969317468 4:6390775-6390797 CAGGACTAGGTGAGTGCAGAGGG - Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970352003 4:15210894-15210916 CAGTGCTTGATGAGGGCTGAGGG + Intergenic
971310109 4:25518428-25518450 TAATGTCAGGTGAGGGAAGAGGG - Intergenic
971490419 4:27206335-27206357 CAGTGCTCTGTGGGGGAAGGGGG - Intergenic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
973960588 4:56105971-56105993 CAGAGCTTGGGGATGGAAGAAGG - Intergenic
975129230 4:70816067-70816089 GACTGCCAGGGGAGGGAAGAAGG + Exonic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975878352 4:78870351-78870373 AAGTGCTAGATGAAGGAATAAGG + Intronic
975901145 4:79154721-79154743 AAGTGCTAGGAGAGGACAGAGGG - Intergenic
976361013 4:84178116-84178138 CTGTCCAATGTGAGGGAAGAAGG - Intergenic
976387642 4:84480022-84480044 CAGTGCCAGGTGAGGGGTGCAGG + Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977032266 4:91900167-91900189 TTGGGCTAGGTGGGGGAAGAGGG + Intergenic
978200194 4:106016758-106016780 CAGTACAAGGGGAGGAAAGAAGG + Intergenic
981000401 4:139823640-139823662 CAGAGCGGGGTGAGGGAAGGCGG - Intronic
983258820 4:165432860-165432882 CAGTGCTTGGTGAGGGCTGGAGG - Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
984221141 4:176977964-176977986 CAGTGATATGTGTGGCAAGATGG - Intergenic
984287389 4:177749569-177749591 CAGAGGTGGGTGAGGGTAGAGGG - Intronic
984514089 4:180716964-180716986 GAGTGCAAGGTGATGGAGGATGG + Intergenic
984824278 4:183910499-183910521 CAGGGCTGGGGGAGGGGAGAGGG - Intronic
985091128 4:186363654-186363676 CAGTGATAGGTGAGGCCACATGG - Intergenic
985407071 4:189648431-189648453 AAGTGCTTGGTAAGGTAAGATGG + Intergenic
985627577 5:997851-997873 CAGAGCCAGGTGAGGGCAGATGG - Intergenic
985629911 5:1008927-1008949 CGGTAGGAGGTGAGGGAAGATGG - Exonic
986053593 5:4113486-4113508 CAGTGCTGGATCAAGGAAGAGGG + Intergenic
987984919 5:25134152-25134174 CTCTGCTAGGTCAGGGAGGAAGG + Intergenic
989182408 5:38591748-38591770 CATTGCTAGGTGGGAGAAGGGGG + Intronic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991562056 5:67964301-67964323 CAGCCCCAGGTGAGGGATGAGGG - Intergenic
991632187 5:68667201-68667223 TAGTGCAAGGTGAGGGTTGAGGG + Intergenic
992158936 5:73981896-73981918 CAGTGGTAGGGAAGGGAAAAGGG - Intergenic
992518802 5:77525619-77525641 CCCTGCAAGGTGAAGGAAGAGGG - Intronic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
993719843 5:91311429-91311451 CTGTGCTAGGTAGGGGTAGAGGG - Intergenic
996798358 5:127375632-127375654 CAGAGCTAGAGCAGGGAAGAGGG - Intronic
998173633 5:139886867-139886889 GAGAGCTAGGTAAGGGAAAAGGG - Intronic
998472883 5:142397029-142397051 CAGTACCAGGTGAGGGCATAGGG + Intergenic
999723555 5:154416898-154416920 CACTGCTGGGTGAGAGAGGATGG - Exonic
999734655 5:154503824-154503846 CAATGCAAGGAGAGGAAAGAAGG + Intergenic
1000716597 5:164652075-164652097 CATTGCTCTGTGAGGGAAAAAGG - Intergenic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1002869204 6:1150706-1150728 GAGTGCTTGGGGAGGGCAGAGGG - Intergenic
1002944811 6:1750872-1750894 CAGCGCTTGGTGGGGGAAGGGGG + Intronic
1005673344 6:28129120-28129142 CAATACTATGTAAGGGAAGACGG - Intronic
1006841917 6:37033921-37033943 CAGGGCTATGTGAGCTAAGATGG - Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011261252 6:85472118-85472140 CAGTGCAAGGTGGGGGAAGTGGG - Intronic
1012239942 6:96860307-96860329 CTCTGCTAGGTCAGTGAAGAAGG + Intergenic
1013050793 6:106533206-106533228 TGGAGCTAGCTGAGGGAAGAGGG + Intronic
1013275631 6:108582260-108582282 ATGTGCTAGGTGTGGGAAGCAGG + Intronic
1013345178 6:109253175-109253197 GAGTGCAAAGTGAGGGAAGGTGG - Intergenic
1013356768 6:109352081-109352103 CAATGTGAGGTGAGAGAAGAAGG - Intergenic
1013676055 6:112464281-112464303 CAAAGCTAGGGCAGGGAAGAAGG + Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014074160 6:117217426-117217448 GACTGGTAGGTGGGGGAAGAAGG - Intergenic
1014475729 6:121870475-121870497 CAGTGCTAGGGAAAGAAAGATGG - Intergenic
1014847545 6:126296980-126297002 CTGTTGTAGGTGAGGGGAGAAGG - Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1016305365 6:142678504-142678526 CAGTGTTAGGTGAGGGCACCTGG + Intergenic
1016361310 6:143270215-143270237 CTCTGCTAAGTGTGGGAAGAGGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017453323 6:154575007-154575029 GAGTGGTTGGTGGGGGAAGAAGG + Intergenic
1017722761 6:157255508-157255530 TAGAGATAGGTGTGGGAAGAGGG - Intergenic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1018725001 6:166605082-166605104 CAGTTCTAGGAGAGGCAAGAGGG - Intronic
1018838288 6:167501247-167501269 CAGTGCCAGCTGGGGCAAGAGGG - Intergenic
1019201004 6:170315145-170315167 CAGAGCTTGGTGAGAGAAGTGGG + Intronic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1021093753 7:16511884-16511906 CCGTGCTGGGTGTGGGAAAAGGG + Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022049092 7:26647742-26647764 CAGAGGCAGGTGAGGGGAGATGG - Intergenic
1022729676 7:33010545-33010567 CATTCCTAGGAGAGGGAACAGGG - Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1024413753 7:49078870-49078892 CACTGCTAGGTCAGTGCAGAAGG - Intergenic
1027436056 7:78165583-78165605 CAGTGCTGTGTGTGGGAAAAGGG - Intronic
1027453165 7:78356210-78356232 CAGTTCTATGTGAGGGAGAATGG + Intronic
1027747462 7:82095276-82095298 CTCTGCTGGGTGAGGGGAGATGG - Intronic
1028389596 7:90299947-90299969 CAATGCTTGGCAAGGGAAGAAGG + Exonic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034801981 7:154060597-154060619 CAGAGCCAGGGGGGGGAAGAGGG - Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035494498 7:159311370-159311392 CAAAGCTAGGGCAGGGAAGAAGG - Intergenic
1035910655 8:3562165-3562187 CAGTAGTAGGTGGGGAAAGATGG + Intronic
1038009662 8:23464975-23464997 CACTGGTAGGTGAGAGAAAAGGG + Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1039390673 8:37178791-37178813 CAGTGCTCAGTGAAGGAGGAGGG + Intergenic
1041329562 8:56710322-56710344 CTGTGCTTTGTGAGTGAAGATGG + Intergenic
1043262527 8:78220106-78220128 CTCTGCTAGGGCAGGGAAGAAGG - Intergenic
1045845522 8:106630905-106630927 CTGTGCTAGCTGAGGGCAGAAGG + Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1049257811 8:141623239-141623261 TGGTGCTAGGTGAGCAAAGATGG - Intergenic
1049425459 8:142536054-142536076 GAGCACTAGGTGAGGGAACAGGG + Intronic
1049798162 8:144505805-144505827 CAGTGCTGGGTGAGCCAAGGGGG - Intronic
1051039229 9:12785728-12785750 CACTGCTAGGAGATGGAGGAGGG + Intronic
1051080192 9:13285144-13285166 CAGTGCAATGTGAGGTGAGAAGG - Intergenic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1055101372 9:72469081-72469103 CAGTGCTGGGTTAGGGAGGGAGG + Intergenic
1056135966 9:83629587-83629609 AAGGGCTAGCTCAGGGAAGAAGG - Intronic
1058967008 9:110048197-110048219 TGGTGCTAGGTAAGGGACGAGGG + Intronic
1060152650 9:121298788-121298810 CAGTGCTAGGAGGGAGGAGAGGG + Intronic
1060586082 9:124786909-124786931 CAGTGCTATGGCAGGGAGGAAGG - Intronic
1061063819 9:128265295-128265317 AAGTCCTAGGTGGGGGAATATGG - Intronic
1061182077 9:129030274-129030296 CAGGGCTGGGAGAGGGAACAGGG - Intergenic
1062184346 9:135209541-135209563 AGCTGCTAGCTGAGGGAAGAGGG + Intergenic
1062269513 9:135702184-135702206 CAGGGCAACGCGAGGGAAGAAGG + Exonic
1062331935 9:136048761-136048783 CAGTGCTGGTTGGGGGCAGAGGG - Intronic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185752921 X:2628411-2628433 CAGTGCATGGTGAGAGAAGCAGG + Intergenic
1186512557 X:10140940-10140962 CAGAGCTAGGGGAGGGAGAACGG - Intronic
1186600260 X:11029160-11029182 CTGAGCTATATGAGGGAAGATGG + Intergenic
1186788909 X:12977954-12977976 AAGTCCTTGGTGCGGGAAGACGG + Intergenic
1187412498 X:19063318-19063340 CAGGGCTAGGGGAGTGGAGAGGG - Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1188239794 X:27771856-27771878 CAGTGATAGGTTATGGAACAGGG + Intergenic
1189119211 X:38376053-38376075 TACTGCTAAGTGAAGGAAGAGGG + Intronic
1189222486 X:39384237-39384259 CAATGATAGGTGAAGTAAGAGGG - Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1192890802 X:75388991-75389013 CACTGCTAGGAGATGGGAGAGGG - Intronic
1193038033 X:76974578-76974600 CAGTGCTAGGGCAATGAAGAAGG + Intergenic
1193870711 X:86794849-86794871 CAGTGGTAGGTAAGGTTAGATGG + Intronic
1194366605 X:93020846-93020868 CATTCCTAGGAGAGAGAAGAAGG + Intergenic
1194702719 X:97134115-97134137 CAGTTTTAGGTGAAGGATGAAGG + Intronic
1194863662 X:99037736-99037758 CAGTGCCGGGTAAGGGAAGCAGG + Intergenic
1195400009 X:104451325-104451347 CAGAGCTTGGGTAGGGAAGAGGG - Intergenic
1196251514 X:113465776-113465798 CAGAGCTAGGCCAGGAAAGATGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1198013965 X:132589752-132589774 CTTTGCTAGGGGAGAGAAGAAGG + Intergenic
1198132843 X:133715860-133715882 CAGTCAAAGGTGAGGGAATAGGG - Intronic
1200014122 X:153146395-153146417 CAGAGGTAGGTGATGGAATAGGG + Intergenic
1200025478 X:153253557-153253579 CAGAGGTAGGTGATGGAATAGGG - Intergenic
1200253218 X:154564741-154564763 CAGTGCCGGGTGGAGGAAGAGGG - Exonic
1200264549 X:154639674-154639696 CAGTGCCGGGTGGAGGAAGAGGG + Intergenic
1200674832 Y:6137107-6137129 CATTCCTAGGAGAGAGAAGAAGG + Intergenic