ID: 1038261974

View in Genome Browser
Species Human (GRCh38)
Location 8:26003499-26003521
Sequence CTGGAATCAGATCCGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038261972_1038261974 -8 Left 1038261972 8:26003484-26003506 CCTGTATTGGAACTTCTGGAATC 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1038261974 8:26003499-26003521 CTGGAATCAGATCCGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038261974 Original CRISPR CTGGAATCAGATCCGGCTTC AGG Intronic
No off target data available for this crispr