ID: 1038262597

View in Genome Browser
Species Human (GRCh38)
Location 8:26010046-26010068
Sequence GTGTGGCCTATCTCCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038262597_1038262601 -4 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262601 8:26010065-26010087 ACACATCAGAACGGAAAGTCGGG No data
1038262597_1038262604 -1 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262604 8:26010068-26010090 CATCAGAACGGAAAGTCGGGGGG No data
1038262597_1038262607 29 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262607 8:26010098-26010120 AGAAAAGGAGCCTGAGGTCATGG No data
1038262597_1038262603 -2 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262603 8:26010067-26010089 ACATCAGAACGGAAAGTCGGGGG No data
1038262597_1038262606 23 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262606 8:26010092-26010114 ACAGAAAGAAAAGGAGCCTGAGG No data
1038262597_1038262600 -5 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262600 8:26010064-26010086 CACACATCAGAACGGAAAGTCGG No data
1038262597_1038262602 -3 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262602 8:26010066-26010088 CACATCAGAACGGAAAGTCGGGG No data
1038262597_1038262605 14 Left 1038262597 8:26010046-26010068 CCTGTCATGGAGATAGGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1038262605 8:26010083-26010105 TCGGGGGGAACAGAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038262597 Original CRISPR GTGTGGCCTATCTCCATGAC AGG (reversed) Intronic
901878786 1:12181846-12181868 GTGTGGCCCATCCACATGAGAGG - Intronic
904933052 1:34105891-34105913 TTGTTGCCTATCTTCATGATTGG + Intronic
908829553 1:68165488-68165510 GTGTGGCCTCTTTCCAGGTCTGG + Intronic
908966585 1:69772327-69772349 GTGTGGCATATTTACAGGACAGG + Intronic
909383001 1:75022693-75022715 GATTGGCCTACCTCCAAGACTGG + Intergenic
916354992 1:163895036-163895058 GTTTGGCCAATGTGCATGACAGG - Intergenic
917957710 1:180117415-180117437 GCGGGGCTTATCTCCATGAGCGG - Intergenic
919589276 1:199480064-199480086 TTCTGGCTTATTTCCATGACTGG - Intergenic
920563606 1:206956833-206956855 GTCTGTCCTATCTCCGTTACAGG + Intergenic
920983733 1:210863883-210863905 TTGAGGCCTTTCTACATGACAGG - Intronic
1064030804 10:11881496-11881518 GTGTGGCCTGGCTCCGTGTCAGG - Intergenic
1070668993 10:78364922-78364944 GTCTGGGCTATCTCCAGGGCTGG - Intergenic
1072756029 10:98021626-98021648 GTGTGGACTTTCTCTATGCCAGG - Intronic
1074883199 10:117674381-117674403 CTGTGGCTTATCTCAAAGACAGG + Intergenic
1075406630 10:122199860-122199882 GTGTGTCCTTTCACCATGTCAGG - Intronic
1077989467 11:7390916-7390938 ATGTGCACTATCTCCATGACAGG - Intronic
1078892444 11:15569537-15569559 CTGTGGCCTAGCACCATGCCCGG + Intergenic
1083832698 11:65242969-65242991 GTGTGTCTTACCTCCTTGACAGG + Intergenic
1085176752 11:74494355-74494377 GTGTAGCCTGTATCCATGACTGG - Intronic
1085217897 11:74848462-74848484 TTCTGGCCCTTCTCCATGACAGG - Exonic
1086231396 11:84574794-84574816 TTGTTGCCTATCTCAGTGACTGG + Intronic
1086536746 11:87856236-87856258 GTGTGGTCCACTTCCATGACTGG + Intergenic
1089116589 11:116100193-116100215 GTGTGGCCTCTCTCCTGGTCCGG - Intergenic
1095085941 12:38057418-38057440 GGGAGGCGTATCTCCTTGACTGG + Intergenic
1102470424 12:113156888-113156910 GTGGAGCCTTTCTCCTTGACGGG - Intronic
1103036097 12:117657807-117657829 GTGTGTGCTAGCTCCATGCCAGG + Intronic
1109438178 13:62334104-62334126 ATGTGGGCTGTCTCAATGACTGG + Intergenic
1121033311 14:90677707-90677729 GTGTGGCCTTTCTGAATGTCAGG - Intronic
1121814894 14:96921627-96921649 GTGGGCCCCAGCTCCATGACTGG - Intronic
1126697332 15:51337673-51337695 CAGTGACCTATCTCCATCACTGG - Intronic
1127126452 15:55817228-55817250 GTGTGCCCTATCTCCTTTACTGG + Intergenic
1133056109 16:3146147-3146169 CTGGGGCCTCTCTCCATCACTGG + Intronic
1136911610 16:34148626-34148648 GAGGGGCATATCTCCTTGACTGG - Intergenic
1140054514 16:71514104-71514126 CTGGGGTCTATCTCCATGCCTGG - Intronic
1141767374 16:86067632-86067654 GTGTGGCCTAGCGTCATGGCTGG - Intergenic
1146243881 17:31260526-31260548 GTGTTCACTATCCCCATGACTGG - Intronic
1154970070 18:21399255-21399277 GTGTGGCATATCTACTTCACAGG + Intronic
1166380248 19:42351797-42351819 CTGTGTCCTTCCTCCATGACCGG + Intronic
926582794 2:14649533-14649555 GTGTAGCCTATATCCAGCACGGG + Intronic
927673500 2:25088686-25088708 GGGTGTCCTATCTCTATAACAGG - Intronic
937765182 2:125652670-125652692 CTGTGGCTTTTCTCCATCACAGG + Intergenic
947135054 2:226969009-226969031 TTTTGGCCTGTGTCCATGACTGG - Intronic
948363999 2:237442846-237442868 GAGTGGCCCACCTCCATGGCTGG + Intergenic
1170657091 20:18298067-18298089 GTGTTTCCTGTCTCCATTACTGG + Intronic
1170770338 20:19327238-19327260 GTGTGTCCTCACTCCATGGCGGG + Intronic
1171769628 20:29312615-29312637 GAGGGGCATATCTCCTTGACTGG + Intergenic
1177807215 21:25886073-25886095 GTCTGGTCCATCTCAATGACAGG - Intronic
1178362895 21:31964573-31964595 GTGTGGCCTGTGGCCATGCCTGG + Intronic
1179901947 21:44398980-44399002 GTGTGGCCTATGCCCAGGAATGG + Intronic
1180842622 22:18966350-18966372 TTGTGGCCCATCTCCAGGATGGG - Intergenic
1181058856 22:20272506-20272528 TTGTGGCCCATCTCCAGGATGGG + Intronic
954530190 3:51311799-51311821 GTGGGGCATTTCTCCAAGACTGG + Intronic
958955511 3:100461709-100461731 GTGTTCCCTATCTCAGTGACTGG + Intergenic
965536535 3:169829337-169829359 GTGTGACCTCTCTCCCTGATTGG + Intronic
972722413 4:41713540-41713562 CTGTCGCCTACCGCCATGACTGG - Intergenic
974421320 4:61679309-61679331 GCGTGGCCCATCTCCAACACTGG + Intronic
976184288 4:82429700-82429722 GCGTGGCCTCTCTCCTTGCCGGG - Exonic
978160444 4:105540791-105540813 CTGTGGCCTACCTCCATGATAGG - Intergenic
978625564 4:110680894-110680916 GTGTTACCTATCTCAATGAACGG - Intergenic
981238579 4:142447830-142447852 GTGTGGCCTGCCTACATGAGAGG + Intronic
981797964 4:148619626-148619648 ATGTGTCCTATTTTCATGACCGG - Intergenic
982360154 4:154511005-154511027 TTTTGGGCTATCTCCATCACTGG + Intergenic
983302314 4:165942452-165942474 GTTTTGTCTATCTCCATGATTGG + Intronic
985385538 4:189443555-189443577 TTCTGGCCTCTCTCCATGCCTGG - Intergenic
994035083 5:95189602-95189624 ATGTGCCCTATTTCCTTGACTGG - Intronic
994280182 5:97892717-97892739 GTGAGCCCTATTTCAATGACTGG + Intergenic
997860623 5:137412085-137412107 GTGCAGTCCATCTCCATGACAGG - Intronic
999955180 5:156693343-156693365 ATGTGCCCTATCTCTCTGACAGG - Intronic
1007101407 6:39249860-39249882 GTGTTGCTTATCTCCAGGCCAGG + Intergenic
1010098203 6:72071981-72072003 GTCTGCACTATCTCCATAACTGG - Intronic
1014217503 6:118766917-118766939 CTGTGTCCTGTCTCGATGACGGG + Intergenic
1016353685 6:143194988-143195010 GTTGGGCCAATCTCCATGAATGG - Intronic
1024854462 7:53761596-53761618 GTGTGGAGTCTGTCCATGACTGG - Intergenic
1024975274 7:55108400-55108422 GTGTGGGTTATCTCCATAAATGG + Intronic
1028948943 7:96612163-96612185 GTGTGCCCTGTCTACATCACAGG - Intronic
1030819663 7:114080835-114080857 GTGTGGGCTTCCTCCATGCCTGG + Intergenic
1035438115 7:158874641-158874663 GTGTGGCCTTTATCCAGGGCTGG + Intronic
1036044673 8:5126591-5126613 GTTGTGTCTATCTCCATGACAGG - Intergenic
1037617804 8:20535146-20535168 GAGTGGCCTCTCTCCAAGACAGG + Intergenic
1038262597 8:26010046-26010068 GTGTGGCCTATCTCCATGACAGG - Intronic
1040885195 8:52255194-52255216 GAGTGCTCTATTTCCATGACTGG + Intronic
1043809876 8:84725291-84725313 GTGTGGCCTATATCCATTCTTGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1050391520 9:5148543-5148565 GTATGGCCTATTTCCCTAACTGG - Intronic
1055797706 9:79993335-79993357 GAGTGGCCGATCCCCATGAAGGG - Intergenic
1058955988 9:109949193-109949215 ATGTGGCCTGTCTCCCTGAAAGG - Intronic
1061185921 9:129053242-129053264 CTGTGGCATATCTACATGCCAGG + Intronic
1187022148 X:15394885-15394907 TAGTGGCCAATCTCCAGGACAGG - Intronic
1192555265 X:72084232-72084254 GTGAGGCCTATGTCAGTGACTGG + Intergenic
1198277738 X:135112522-135112544 ATGTGGCCTATCTCCCTTCCAGG - Intergenic