ID: 1038264556

View in Genome Browser
Species Human (GRCh38)
Location 8:26028223-26028245
Sequence CACAATGACCTTCATTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038264556 Original CRISPR CACAATGACCTTCATTCAAA AGG (reversed) Intronic
900204350 1:1425775-1425797 CACAAAGACCTCATTTCAAAGGG - Intergenic
900277274 1:1839181-1839203 CAAAATTACCTTAATTCAGAAGG + Intronic
901246352 1:7734631-7734653 CAAACTGACCTTGACTCAAAAGG - Intronic
902738345 1:18416213-18416235 CAAAAAGATCTTCGTTCAAAAGG + Intergenic
904082094 1:27878699-27878721 AACAAGGACATTCATTCACATGG + Intronic
905516199 1:38563807-38563829 CACAATCACCTACATGCAAGGGG + Intergenic
906250485 1:44307273-44307295 CTCAATGCCCAGCATTCAAACGG + Intronic
906356300 1:45108367-45108389 AACAATAAACTTCTTTCAAAAGG + Intronic
907030713 1:51168576-51168598 CACAATAACCCTCATTCCACGGG + Intergenic
907359422 1:53902771-53902793 CACAGGGACCTACACTCAAAAGG + Intronic
910719534 1:90270946-90270968 CACGATGAACATCATTAAAAGGG + Intergenic
910984802 1:92994997-92995019 CACAAAGACCTGCATTAAAAAGG - Intergenic
912168164 1:107064554-107064576 TACAGTTACCTGCATTCAAAAGG + Intergenic
917263388 1:173193990-173194012 CACAAAGACTCTAATTCAAAAGG + Intronic
917300362 1:173567754-173567776 GAAAATCACCTTCATTGAAAGGG - Intronic
921334542 1:214073065-214073087 TACAATTACCTTCATTCTTAAGG - Intergenic
921335383 1:214080343-214080365 CACAATCACCTTCTTTTTAATGG + Intergenic
922035771 1:221846394-221846416 CACAACGACATCCATGCAAAAGG + Intergenic
922204412 1:223434006-223434028 TAAAATGTCCTTCCTTCAAACGG - Intergenic
924872490 1:248064012-248064034 CACAAGGTCCTACACTCAAAGGG - Intronic
1068816836 10:61325547-61325569 GACCATGAGCTTCATCCAAATGG + Intergenic
1068860892 10:61846657-61846679 CAGAAGGAGCTTCATTCCAATGG + Intergenic
1071558035 10:86621211-86621233 CACAAAGACATTCCATCAAAAGG - Intergenic
1073943777 10:108728635-108728657 CACAATGAGATTCCATCAAATGG + Intergenic
1075826694 10:125363066-125363088 CACAATCCCCTTCATTCAGTGGG + Intergenic
1078867222 11:15309123-15309145 CACATTGGCTTTCATTAAAAGGG - Intergenic
1079096279 11:17512473-17512495 CACAATGCCCTTTATTTATATGG - Intronic
1080062353 11:27970468-27970490 CACAAAGATCTTCTTCCAAATGG + Intergenic
1081140791 11:39496581-39496603 CATTATGATCTTCAGTCAAAGGG + Intergenic
1082029430 11:47593996-47594018 CACAAGGGCTTTCATTCCAAAGG - Intronic
1084960892 11:72715870-72715892 CATTAAGACCTTCATACAAATGG + Intronic
1086164402 11:83760924-83760946 GACAATGAGGTACATTCAAAGGG - Intronic
1086762435 11:90649300-90649322 CAGAATCAACTTCATTAAAATGG + Intergenic
1087246231 11:95840912-95840934 CCCAATGAGCTGCATTCAACAGG + Intronic
1087720668 11:101661939-101661961 GAAAATTACCTTCATTAAAAGGG - Intronic
1087841225 11:102922912-102922934 CATAATGCCATTCACTCAAAGGG + Intergenic
1089791681 11:120949730-120949752 CACACTCTCCTTCATTCAAATGG - Intronic
1092071046 12:5631684-5631706 CTCAGTGACCCTCCTTCAAAGGG - Intronic
1092835888 12:12487893-12487915 CCCCATGACCCTCATCCAAATGG + Intronic
1092986330 12:13849540-13849562 CTCTATGACCTCCATTCAGAGGG + Intronic
1093237258 12:16626626-16626648 CACAATGACACTAATTCAATGGG - Intergenic
1095364132 12:41382064-41382086 CACAATCACCTTTGGTCAAATGG + Intronic
1095613425 12:44159798-44159820 CAGAATGAACTTAATTCAGATGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1096960744 12:55574627-55574649 CACAAACATCTTCATTCCAAGGG + Exonic
1097505831 12:60468375-60468397 GACAATTACCTTCAGCCAAAAGG - Intergenic
1097996456 12:65892911-65892933 CAAAATGGCCTTGATTCACAGGG + Intronic
1098324063 12:69282038-69282060 CACAATGAGAGTCATTTAAAAGG + Intergenic
1099599157 12:84710033-84710055 CACTGTGACTTTCATTCATAAGG - Intergenic
1099639177 12:85262481-85262503 GAAAAAGACCTTCATTCAACCGG + Intronic
1100408076 12:94288287-94288309 GACAGTTACCTTCATCCAAAGGG + Intronic
1103035396 12:117652552-117652574 CAGCCTGCCCTTCATTCAAAGGG - Intronic
1103969768 12:124663217-124663239 CACAAGGACATTTATTGAAAAGG - Intergenic
1106970911 13:35140592-35140614 CAAAATGACCTAAACTCAAAAGG - Intronic
1110097761 13:71551722-71551744 CATAATGATTTTCTTTCAAAAGG + Intronic
1110685752 13:78371999-78372021 CAGAATGACCATTATTAAAAAGG - Intergenic
1111220343 13:85197061-85197083 GACACTGACTTTCATTCAGATGG - Intergenic
1112947619 13:104950688-104950710 CAGAATGAGCTGTATTCAAAGGG - Intergenic
1113560547 13:111276216-111276238 CACATTGACATACATTCAATGGG + Intronic
1116039772 14:39671680-39671702 CAAAGTCACCTTCATGCAAATGG + Intergenic
1118033731 14:61843249-61843271 TAAAATGGCTTTCATTCAAAAGG - Intergenic
1118170411 14:63383418-63383440 CAGAATGACCTTCCTCCCAAGGG + Intronic
1118919046 14:70133296-70133318 CAGAATGACCTTCACTCAACAGG + Intronic
1120053829 14:79899214-79899236 CACAGTGACCTACATTCAAGGGG - Intergenic
1120854234 14:89199141-89199163 CTCAATAACCTTCAGCCAAAAGG - Intronic
1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG + Intronic
1126136228 15:45394727-45394749 AACAGTGACCTTCATTTCAATGG + Intronic
1126455229 15:48854284-48854306 CAGAATGACTATCATTAAAAAGG + Intronic
1128021148 15:64391621-64391643 TAAAATGACATTTATTCAAATGG + Intronic
1133875959 16:9734592-9734614 CACAAAGACTTTCATTCAGGGGG + Intergenic
1141449741 16:84090424-84090446 CACAGTGACACTCATTCACAGGG - Intronic
1145877149 17:28327707-28327729 AACAATGACTTTCAGTCAAATGG + Exonic
1147665594 17:42145276-42145298 CACAGTGACTTTCTTCCAAAGGG + Intronic
1150980359 17:70134438-70134460 CACAAAATCCTTCATTTAAATGG - Exonic
1152450690 17:80377698-80377720 CCCAATGACCCACATTGAAAAGG - Intronic
1153142729 18:1993417-1993439 CACAAAGAACTCCCTTCAAATGG + Intergenic
1155922500 18:31617182-31617204 CAAAATGACATTCATACCAAGGG + Intergenic
1155984847 18:32218852-32218874 CATAACAGCCTTCATTCAAAGGG + Intronic
1161228465 19:3159709-3159731 TACAATGACCTTCTTTCATGCGG + Intronic
1161577597 19:5063456-5063478 CCCGATGACCTTCATCTAAAGGG - Intronic
1162684857 19:12373728-12373750 CTAAATGACCTTCCTTCAAAGGG + Intergenic
1164207235 19:23069142-23069164 CACAATGACCCACATGCACAGGG + Intergenic
1167650848 19:50727819-50727841 CACAAGCATCTTCATTCAAAGGG - Intergenic
925938743 2:8794204-8794226 AAGAATGACCTTCATTCTAGAGG - Intronic
926458442 2:13098247-13098269 TAAAATGACCTTTATTAAAAAGG - Intergenic
926579591 2:14620380-14620402 CTCAAGGACCTTCATTGAAATGG - Intergenic
927184996 2:20475690-20475712 CATAAGGACCTTCATCCATAAGG + Intergenic
927489957 2:23514688-23514710 CACACTGACCTTCTTCCTAACGG - Intronic
927500344 2:23578585-23578607 CTCAAGGACCTTCATTCTAGAGG - Intronic
928021811 2:27711299-27711321 AACAATAACCTTGATTAAAAGGG + Intronic
928357756 2:30635903-30635925 CACAATGCCCTCCACTAAAAAGG - Intronic
930588764 2:53301915-53301937 CAAAATGACCTTAATTTAAAAGG + Intergenic
930698688 2:54437905-54437927 CACAATAAGCTTCAGTTAAAGGG - Intergenic
932419091 2:71590911-71590933 CAGAATGACCTAGATACAAAGGG - Intronic
932652487 2:73573627-73573649 AGCAAAGCCCTTCATTCAAAAGG - Intronic
933091516 2:78125232-78125254 CACAATGACCTTGAAGCATATGG - Intergenic
935764894 2:106357049-106357071 CAGAATGAACTTCAGTGAAAGGG + Intergenic
938692626 2:133806316-133806338 CAAAATGAACTTGATTCAAACGG + Intergenic
939323274 2:140651924-140651946 GAAAATGAACTTCATTCTAAAGG + Intronic
940524707 2:154798763-154798785 CAAAATTACCTTCTTTTAAAAGG + Intronic
941684291 2:168431905-168431927 CAGAATGACTGTCATTCAAGAGG - Intergenic
945000666 2:205346622-205346644 CACAAAGACCATCCTTCATATGG + Intronic
1173235467 20:41241186-41241208 TAAAATGACCTTTATCCAAAAGG - Intronic
1178637831 21:34320541-34320563 CAGAATGACATGAATTCAAAGGG - Intergenic
1178923968 21:36760123-36760145 CATAATGAACTTCATTTACAAGG - Intronic
949578805 3:5365815-5365837 CACAATGACCCTATTTCCAAAGG - Intergenic
951570709 3:24059764-24059786 TCCAAAGACATTCATTCAAATGG + Intergenic
952082526 3:29777566-29777588 CTCAAAAACCTTCTTTCAAATGG + Intronic
955514542 3:59713718-59713740 CAGCATTAACTTCATTCAAAAGG + Intergenic
959256889 3:104026782-104026804 CAAAATGACTTTCTTCCAAAGGG - Intergenic
960880652 3:122341390-122341412 CAAAAGGAGATTCATTCAAATGG - Intronic
961669758 3:128520442-128520464 CACAATGACCATCATTTATGAGG - Intergenic
962281515 3:134055565-134055587 CACCATGACCATCTTTGAAAGGG - Intergenic
964065821 3:152577571-152577593 CACAATGTCCAACATTCAATAGG + Intergenic
965188287 3:165494455-165494477 CAAAATTATCCTCATTCAAATGG - Intergenic
965377125 3:167939111-167939133 GGCAATGACCTTCCTTCAAATGG + Intergenic
965471954 3:169104821-169104843 CACAGTGATCTTTCTTCAAAAGG - Intronic
967006581 3:185389232-185389254 CACAATCCCATTCTTTCAAAGGG + Intronic
968174384 3:196536699-196536721 CTAAATGATCTTCCTTCAAAGGG + Intergenic
968191627 3:196672315-196672337 AACACTGACTTGCATTCAAAAGG - Intronic
970992229 4:22225610-22225632 CAATATGACCTTATTTCAAAAGG + Intergenic
971185997 4:24376629-24376651 AACATTGACCTTTAGTCAAATGG - Intergenic
971724589 4:30294158-30294180 CACAATAACATTTAATCAAATGG - Intergenic
978516646 4:109575948-109575970 CAACCTGACCTTCATTCAATTGG + Intronic
979110578 4:116749978-116750000 TACAATGACTTTCATTGATATGG - Intergenic
980589577 4:134867916-134867938 CTCAAAGACCATAATTCAAAGGG + Intergenic
984052445 4:174882027-174882049 CACAATCACTGTCTTTCAAAGGG + Intronic
986075387 5:4331464-4331486 CACAATAACATTCATTGAAAGGG + Intergenic
986681238 5:10234652-10234674 CACCATGACCATCCTTCCAAAGG + Intronic
987133584 5:14881289-14881311 CACAAGTAGCTTCATTAAAAAGG + Intergenic
988121092 5:26963569-26963591 ACCATTGACCTTCTTTCAAAAGG + Intronic
988534395 5:32053268-32053290 CGCCATGAAATTCATTCAAAAGG - Intronic
990550547 5:56873117-56873139 CATCATGACCTTCATTCCACTGG + Intronic
990994762 5:61720713-61720735 AACAATGACCTTCCTTCACCTGG - Intronic
991149807 5:63354424-63354446 CACTTTCAACTTCATTCAAAAGG - Intergenic
994282240 5:97919533-97919555 CAGACTGATCTTCACTCAAAAGG - Intergenic
994305591 5:98200333-98200355 CACAAGGACCTTCATCTCAATGG - Intergenic
995178546 5:109207931-109207953 CACAATGACCTGTGTGCAAAAGG + Intergenic
996290061 5:121842302-121842324 CACAGGGACCTTCACTCAGAGGG - Intergenic
996604301 5:125303240-125303262 CACAATTATCTTTCTTCAAATGG + Intergenic
1010283456 6:74046955-74046977 CACAATAAAATTCATGCAAAAGG + Intergenic
1010355831 6:74932134-74932156 GACATTAACCTCCATTCAAATGG - Intergenic
1010754627 6:79653102-79653124 CAAAATGACCTTCATGTTAAGGG - Intronic
1010778037 6:79909170-79909192 CATAATGGCCTTCATTCCATGGG + Intergenic
1013214895 6:108018410-108018432 CCCAATAACCTTAATTCAAAAGG + Intergenic
1014597419 6:123361879-123361901 CTCAATTACCTCCATGCAAAGGG + Intronic
1015083617 6:129259720-129259742 CACCATGAGCTTGATTTAAAAGG - Intronic
1015635903 6:135273764-135273786 CACAATGGCCTCCATTCTTAAGG + Intergenic
1018165391 6:161089507-161089529 CACACTGACTTTCATCAAAAAGG - Intronic
1019083637 6:169454242-169454264 CCCAATGACCAACATGCAAATGG - Intergenic
1019556433 7:1633801-1633823 CACAGTGACCTTCATGGGAAAGG - Intergenic
1021263321 7:18486379-18486401 CATAAGGCCCTTCCTTCAAAAGG + Intronic
1021263692 7:18492303-18492325 CACAATGACCTTTTCTAAAATGG - Intronic
1021783521 7:24130088-24130110 CAGAATCACATTCATTCACAGGG + Intergenic
1024487468 7:49934597-49934619 CACAATAATATTCAATCAAATGG + Intronic
1027483531 7:78729613-78729635 CACAATGGCCCTCATCCACATGG + Intronic
1028632445 7:92949680-92949702 GACAATGAACTTCTTTCTAAAGG - Intergenic
1031325590 7:120393118-120393140 CTCAACGTCATTCATTCAAAAGG - Intronic
1032313666 7:130813689-130813711 CACACTGACCTTCATTAAACAGG - Intergenic
1033851087 7:145496401-145496423 CACAATGAGATTGATCCAAAAGG + Intergenic
1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG + Intergenic
1038264556 8:26028223-26028245 CACAATGACCTTCATTCAAAAGG - Intronic
1038295069 8:26284273-26284295 CTAAATGACCTTCATTGAAGAGG + Intergenic
1039697490 8:39928167-39928189 TACATTAACCTTCCTTCAAAAGG - Exonic
1040478115 8:47798769-47798791 CAACATGACCTACATTTAAATGG - Intronic
1040634820 8:49260612-49260634 CACAGTGAGCTTCATTCCAGAGG + Intergenic
1041807022 8:61862639-61862661 TACAATGACGTGCATTCTAATGG + Intergenic
1044974116 8:97646506-97646528 CACAATGTGCTTCATCCACATGG - Intronic
1048966081 8:139615614-139615636 CTCAGTGACCATCCTTCAAAGGG + Intronic
1049159011 8:141085550-141085572 CACACAGAGCTTCACTCAAAGGG - Intergenic
1049927898 9:427341-427363 GACAGTGACCATCATTCAACTGG - Intronic
1050149354 9:2603835-2603857 CACAATAACCTTTATACAACAGG - Intergenic
1051872360 9:21753349-21753371 CCAACTGACCTTCATTAAAATGG - Intergenic
1052558738 9:30055545-30055567 CACATTTAGCTTGATTCAAAGGG - Intergenic
1057210604 9:93199077-93199099 CACAAGGACCTCCAGTCACAGGG - Intronic
1057346416 9:94255022-94255044 CAGGATGTCCTTCAATCAAAAGG - Intergenic
1058346133 9:103965311-103965333 CAACCTGACCTTCATTCACAGGG - Intergenic
1059025023 9:110617231-110617253 CACAAGGACCCTGATTTAAATGG + Intergenic
1059457391 9:114408173-114408195 CAAATTGACCTTCATTTTAATGG - Intronic
1185529304 X:804859-804881 CACAATACAATTCATTCAAACGG - Intergenic
1186165479 X:6822220-6822242 CACTAAGGCCTTCATTCAAGAGG + Intergenic
1188198335 X:27266863-27266885 AACACTGACTTTCATTCAGAAGG + Intergenic
1188602490 X:31986052-31986074 CACACTCCCCTTCATTCAAGGGG - Intronic
1188965101 X:36541612-36541634 CATAATGTTGTTCATTCAAATGG - Intergenic
1196403168 X:115336970-115336992 CAGATTGAACTTCATTCCAATGG - Intergenic
1196649549 X:118154667-118154689 AACAATGACCTTGCTTCAAGGGG + Intergenic
1197182892 X:123555652-123555674 CACCCTGATCTTGATTCAAAAGG + Intergenic
1199272228 X:145898119-145898141 CACTATGCCTTTCTTTCAAAAGG + Intergenic
1200135070 X:153870817-153870839 CACCAGGACCATCATTCAGAAGG - Exonic
1200868833 Y:8075303-8075325 CACAATGACCTCCTTTGAACAGG + Intergenic
1202248207 Y:22841342-22841364 CACAAAGACCTTCACACAAGGGG + Intergenic
1202401195 Y:24475090-24475112 CACAAAGACCTTCACACAAGGGG + Intergenic
1202469585 Y:25194996-25195018 CACAAAGACCTTCACACAAGGGG - Intergenic