ID: 1038266574

View in Genome Browser
Species Human (GRCh38)
Location 8:26043251-26043273
Sequence CGGGAGCTGCCCTGCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038266563_1038266574 30 Left 1038266563 8:26043198-26043220 CCATCAGATCCCATTTCACCGAA 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG No data
1038266568_1038266574 20 Left 1038266568 8:26043208-26043230 CCATTTCACCGAAGACTTGGGGC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG No data
1038266566_1038266574 21 Left 1038266566 8:26043207-26043229 CCCATTTCACCGAAGACTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG No data
1038266570_1038266574 12 Left 1038266570 8:26043216-26043238 CCGAAGACTTGGGGCTGAGGTGA 0: 1
1: 0
2: 0
3: 25
4: 199
Right 1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038266574 Original CRISPR CGGGAGCTGCCCTGCGGCGC TGG Intronic
No off target data available for this crispr