ID: 1038266752

View in Genome Browser
Species Human (GRCh38)
Location 8:26044178-26044200
Sequence CCCGGCCGCCTCGTCTTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038266737_1038266752 12 Left 1038266737 8:26044143-26044165 CCGGGACCCTCCAGCCTGTCCCC No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266745_1038266752 -9 Left 1038266745 8:26044164-26044186 CCCCTCCCAGAGCTCCCGGCCGC No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266744_1038266752 -8 Left 1038266744 8:26044163-26044185 CCCCCTCCCAGAGCTCCCGGCCG No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266743_1038266752 -7 Left 1038266743 8:26044162-26044184 CCCCCCTCCCAGAGCTCCCGGCC No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266738_1038266752 6 Left 1038266738 8:26044149-26044171 CCCTCCAGCCTGTCCCCCCTCCC No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266741_1038266752 -2 Left 1038266741 8:26044157-26044179 CCTGTCCCCCCTCCCAGAGCTCC No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266740_1038266752 2 Left 1038266740 8:26044153-26044175 CCAGCCTGTCCCCCCTCCCAGAG No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266746_1038266752 -10 Left 1038266746 8:26044165-26044187 CCCTCCCAGAGCTCCCGGCCGCC No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data
1038266739_1038266752 5 Left 1038266739 8:26044150-26044172 CCTCCAGCCTGTCCCCCCTCCCA No data
Right 1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038266752 Original CRISPR CCCGGCCGCCTCGTCTTCCC GGG Intronic