ID: 1038267718

View in Genome Browser
Species Human (GRCh38)
Location 8:26049196-26049218
Sequence GCATAGTGAAGGAGATTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038267715_1038267718 25 Left 1038267715 8:26049148-26049170 CCTTATAGGACAATTTGGGTAAG No data
Right 1038267718 8:26049196-26049218 GCATAGTGAAGGAGATTCAGCGG No data
1038267714_1038267718 26 Left 1038267714 8:26049147-26049169 CCCTTATAGGACAATTTGGGTAA No data
Right 1038267718 8:26049196-26049218 GCATAGTGAAGGAGATTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038267718 Original CRISPR GCATAGTGAAGGAGATTCAG CGG Intergenic
No off target data available for this crispr