ID: 1038269583

View in Genome Browser
Species Human (GRCh38)
Location 8:26064370-26064392
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038269583_1038269585 -6 Left 1038269583 8:26064370-26064392 CCATACTGACACCTGGGGCACCC No data
Right 1038269585 8:26064387-26064409 GCACCCAGTCAATGCCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038269583 Original CRISPR GGGTGCCCCAGGTGTCAGTA TGG (reversed) Intergenic
No off target data available for this crispr