ID: 1038269591

View in Genome Browser
Species Human (GRCh38)
Location 8:26064427-26064449
Sequence GTGACAATTCAGATATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038269591_1038269600 6 Left 1038269591 8:26064427-26064449 CCTCCAAATATCTGAATTGTCAC No data
Right 1038269600 8:26064456-26064478 CCAGGGAACACTCATGTAAATGG No data
1038269591_1038269603 29 Left 1038269591 8:26064427-26064449 CCTCCAAATATCTGAATTGTCAC No data
Right 1038269603 8:26064479-26064501 CCATAGATCTTAGAGGACTTTGG No data
1038269591_1038269601 22 Left 1038269591 8:26064427-26064449 CCTCCAAATATCTGAATTGTCAC No data
Right 1038269601 8:26064472-26064494 TAAATGGCCATAGATCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038269591 Original CRISPR GTGACAATTCAGATATTTGG AGG (reversed) Intergenic
No off target data available for this crispr