ID: 1038271500

View in Genome Browser
Species Human (GRCh38)
Location 8:26079465-26079487
Sequence GCTTATGGATGAGCACATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038271489_1038271500 26 Left 1038271489 8:26079416-26079438 CCTGCCAGTTCTGGAGGTTCCCA No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data
1038271494_1038271500 6 Left 1038271494 8:26079436-26079458 CCAGGAATAGACAGGCCCCAGAT No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data
1038271493_1038271500 7 Left 1038271493 8:26079435-26079457 CCCAGGAATAGACAGGCCCCAGA No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data
1038271491_1038271500 22 Left 1038271491 8:26079420-26079442 CCAGTTCTGGAGGTTCCCAGGAA No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data
1038271488_1038271500 27 Left 1038271488 8:26079415-26079437 CCCTGCCAGTTCTGGAGGTTCCC No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data
1038271498_1038271500 -10 Left 1038271498 8:26079452-26079474 CCCAGATTCACAGGCTTATGGAT No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data
1038271497_1038271500 -9 Left 1038271497 8:26079451-26079473 CCCCAGATTCACAGGCTTATGGA No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data
1038271487_1038271500 28 Left 1038271487 8:26079414-26079436 CCCCTGCCAGTTCTGGAGGTTCC No data
Right 1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038271500 Original CRISPR GCTTATGGATGAGCACATAA AGG Intergenic
No off target data available for this crispr