ID: 1038275622

View in Genome Browser
Species Human (GRCh38)
Location 8:26118405-26118427
Sequence CTGTCTCCTGCCTGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038275622_1038275624 5 Left 1038275622 8:26118405-26118427 CCCACAACACAGGCAGGAGACAG No data
Right 1038275624 8:26118433-26118455 CAGAGTTCTCAAGTTCTACCAGG No data
1038275622_1038275628 30 Left 1038275622 8:26118405-26118427 CCCACAACACAGGCAGGAGACAG No data
Right 1038275628 8:26118458-26118480 CCAACTCTGTGTTCTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038275622 Original CRISPR CTGTCTCCTGCCTGTGTTGT GGG (reversed) Intergenic
No off target data available for this crispr