ID: 1038278521

View in Genome Browser
Species Human (GRCh38)
Location 8:26141866-26141888
Sequence ACATGGCCAGAGAGGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038278521_1038278530 27 Left 1038278521 8:26141866-26141888 CCTTGCTCCCTCTCTGGCCATGT No data
Right 1038278530 8:26141916-26141938 TAATGATTGGAAGCTTCCTGAGG 0: 4
1: 39
2: 602
3: 2158
4: 9273
1038278521_1038278528 14 Left 1038278521 8:26141866-26141888 CCTTGCTCCCTCTCTGGCCATGT No data
Right 1038278528 8:26141903-26141925 CCTTCACCTTCAGTAATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038278521 Original CRISPR ACATGGCCAGAGAGGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr