ID: 1038281743

View in Genome Browser
Species Human (GRCh38)
Location 8:26171385-26171407
Sequence CTTCAGCCTCCTGAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038281743_1038281747 26 Left 1038281743 8:26171385-26171407 CCAGGCTGCTCAGGAGGCTGAAG No data
Right 1038281747 8:26171434-26171456 TGAGATGCAGTGCGCCAGCCTGG No data
1038281743_1038281748 27 Left 1038281743 8:26171385-26171407 CCAGGCTGCTCAGGAGGCTGAAG No data
Right 1038281748 8:26171435-26171457 GAGATGCAGTGCGCCAGCCTGGG No data
1038281743_1038281744 3 Left 1038281743 8:26171385-26171407 CCAGGCTGCTCAGGAGGCTGAAG No data
Right 1038281744 8:26171411-26171433 GAGAATCACTTGAACCCAGAAGG 0: 1135
1: 25195
2: 70741
3: 129192
4: 160840

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038281743 Original CRISPR CTTCAGCCTCCTGAGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr