ID: 1038281748

View in Genome Browser
Species Human (GRCh38)
Location 8:26171435-26171457
Sequence GAGATGCAGTGCGCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038281743_1038281748 27 Left 1038281743 8:26171385-26171407 CCAGGCTGCTCAGGAGGCTGAAG No data
Right 1038281748 8:26171435-26171457 GAGATGCAGTGCGCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038281748 Original CRISPR GAGATGCAGTGCGCCAGCCT GGG Intergenic
No off target data available for this crispr