ID: 1038284827

View in Genome Browser
Species Human (GRCh38)
Location 8:26197439-26197461
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038284827_1038284830 20 Left 1038284827 8:26197439-26197461 CCTGGTGGCTCTCTTGTGTGGCC No data
Right 1038284830 8:26197482-26197504 GACAGCAGTCAGATTCCATTAGG No data
1038284827_1038284829 -2 Left 1038284827 8:26197439-26197461 CCTGGTGGCTCTCTTGTGTGGCC No data
Right 1038284829 8:26197460-26197482 CCAAATTTCTTGTTCTTCTAAGG No data
1038284827_1038284831 21 Left 1038284827 8:26197439-26197461 CCTGGTGGCTCTCTTGTGTGGCC No data
Right 1038284831 8:26197483-26197505 ACAGCAGTCAGATTCCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038284827 Original CRISPR GGCCACACAAGAGAGCCACC AGG (reversed) Intergenic