ID: 1038284831

View in Genome Browser
Species Human (GRCh38)
Location 8:26197483-26197505
Sequence ACAGCAGTCAGATTCCATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038284825_1038284831 25 Left 1038284825 8:26197435-26197457 CCTTCCTGGTGGCTCTCTTGTGT No data
Right 1038284831 8:26197483-26197505 ACAGCAGTCAGATTCCATTAGGG No data
1038284828_1038284831 0 Left 1038284828 8:26197460-26197482 CCAAATTTCTTGTTCTTCTAAGG No data
Right 1038284831 8:26197483-26197505 ACAGCAGTCAGATTCCATTAGGG No data
1038284827_1038284831 21 Left 1038284827 8:26197439-26197461 CCTGGTGGCTCTCTTGTGTGGCC No data
Right 1038284831 8:26197483-26197505 ACAGCAGTCAGATTCCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038284831 Original CRISPR ACAGCAGTCAGATTCCATTA GGG Intergenic