ID: 1038284832

View in Genome Browser
Species Human (GRCh38)
Location 8:26197495-26197517
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038284828_1038284832 12 Left 1038284828 8:26197460-26197482 CCAAATTTCTTGTTCTTCTAAGG No data
Right 1038284832 8:26197495-26197517 TTCCATTAGGGCCCACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038284832 Original CRISPR TTCCATTAGGGCCCACCTAA TGG Intergenic