ID: 1038288007

View in Genome Browser
Species Human (GRCh38)
Location 8:26223288-26223310
Sequence CTGGTCCCTCTCACTCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038288007_1038288010 18 Left 1038288007 8:26223288-26223310 CCCACGGGAGTGAGAGGGACCAG No data
Right 1038288010 8:26223329-26223351 AGTCTGTGAAGCAGTGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038288007 Original CRISPR CTGGTCCCTCTCACTCCCGT GGG (reversed) Intergenic
No off target data available for this crispr