ID: 1038291769

View in Genome Browser
Species Human (GRCh38)
Location 8:26256162-26256184
Sequence AAATTCAAACAGATTGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038291769_1038291777 23 Left 1038291769 8:26256162-26256184 CCTGGGTCAATCTGTTTGAATTT 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1038291777 8:26256208-26256230 CTCCATACTTGAAAGCCTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
1038291769_1038291775 -10 Left 1038291769 8:26256162-26256184 CCTGGGTCAATCTGTTTGAATTT 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1038291775 8:26256175-26256197 GTTTGAATTTCGGGGGTGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 128
1038291769_1038291779 27 Left 1038291769 8:26256162-26256184 CCTGGGTCAATCTGTTTGAATTT 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1038291779 8:26256212-26256234 ATACTTGAAAGCCTTCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038291769 Original CRISPR AAATTCAAACAGATTGACCC AGG (reversed) Intergenic
902288367 1:15421252-15421274 ATCTTCAATCAGGTTGACCCTGG + Intronic
904205669 1:28853601-28853623 ACATTCAAAGTGATTGCCCCTGG + Intronic
904617346 1:31756934-31756956 AAGTTCACACAGGTGGACCCAGG - Intronic
904859736 1:33526877-33526899 TCATACAAACACATTGACCCAGG - Intronic
905831175 1:41069391-41069413 AAATTGAAAGTGATTGCCCCTGG + Intronic
905845448 1:41227364-41227386 AAATTTAAACAGAGTGACTATGG - Intronic
906949785 1:50324966-50324988 ATATTGCAACAGATTGACCATGG + Intergenic
910900548 1:92115533-92115555 AAAATCAAACAGGATGACGCTGG - Intronic
912094794 1:106125712-106125734 AGTTTCAAATAGATTGACCATGG + Intergenic
912467449 1:109883742-109883764 AAATTCATTCAGATTGGCCTTGG + Intergenic
913533053 1:119746815-119746837 AAATTCACACAGGGTGACCTAGG - Intergenic
919442794 1:197658449-197658471 TAATTCAAACAGGTTAATCCTGG + Intronic
921367541 1:214387879-214387901 ATATTTAAATAGATTCACCCTGG - Intronic
923912795 1:238468014-238468036 AAATTCACACACAGTGGCCCTGG - Intergenic
1068229515 10:54153668-54153690 ATATTAAAACAGACTGAACCTGG + Intronic
1069457772 10:68567363-68567385 ATTTTTAAACAGATTGAACCCGG + Intronic
1071337253 10:84611073-84611095 GAATGCAAACAGATTGACAGCGG - Intergenic
1071777670 10:88807309-88807331 AAACTCAAACAGTGGGACCCAGG + Intronic
1074476559 10:113779965-113779987 AAATTCAAACACATAGTCCCTGG + Intronic
1075516729 10:123115017-123115039 AAATTCAAACATCTTGAGCCAGG - Intergenic
1079807547 11:24953328-24953350 ATATTCAAGCAGATTCACACAGG + Intronic
1081045898 11:38272574-38272596 AAAGTCAAAGAGAGTGTCCCTGG - Intergenic
1083840735 11:65302707-65302729 AAATTCAAACAGGTTGAGTGTGG - Intronic
1084992755 11:72943610-72943632 AAAGTCAAATAGACTGACCCAGG - Intronic
1087936688 11:104042322-104042344 AGATTCTAACAGATGGACCCAGG - Intronic
1092029603 12:5273518-5273540 GAATTCAAACCCATGGACCCAGG + Intergenic
1093083242 12:14837948-14837970 AAATTCAAACAGAGTGGGTCTGG + Intronic
1093094268 12:14954471-14954493 AAAATCAAACGGAATGACCACGG - Intronic
1094608929 12:31974438-31974460 GAAATCAAACATATTGACCCTGG - Intronic
1095367498 12:41425400-41425422 AAATTCAAATATATTGGCCTAGG + Intronic
1099749806 12:86758603-86758625 AAATTCAAACACAGTCACTCTGG + Intronic
1099754347 12:86824162-86824184 AAATCTTATCAGATTGACCCTGG + Intronic
1101072294 12:101088332-101088354 AATTTAAAACAGAGTGACCAGGG - Intronic
1102556684 12:113731335-113731357 AAATTCAAACTTTTTGACTCTGG - Intergenic
1103155345 12:118680040-118680062 AAATTAAAATAGATTCAGCCGGG - Intergenic
1104348825 12:128027178-128027200 AGATTCAAAAAGAGTGAACCAGG - Intergenic
1104734232 12:131127091-131127113 AAATGAAACCAGACTGACCCAGG + Intronic
1107250448 13:38353502-38353524 AAGTTCATACAGATTGACCCTGG + Intronic
1107504678 13:41021514-41021536 AAAGGCAAACAGTTTGACACAGG + Intronic
1107760504 13:43673273-43673295 AAATTAAAACAGATTGATGGAGG + Intronic
1109560092 13:64035887-64035909 ATATTAAAATAGTTTGACCCAGG + Intergenic
1109768911 13:66943922-66943944 AAATACAAACTGCATGACCCTGG + Intronic
1110148663 13:72224071-72224093 AAATCCAAACAGATTCACCAAGG + Intergenic
1110682874 13:78337100-78337122 AGATTCACACAAATTGTCCCAGG + Intergenic
1111890561 13:94076852-94076874 TAATTCAAACAGTATGACACTGG - Intronic
1114402326 14:22421295-22421317 AAGTCCAAACAGATTGACCTTGG + Intergenic
1120628493 14:86859098-86859120 AAATTCAAACAAATGGATCATGG - Intergenic
1121544715 14:94754991-94755013 AAATTCAAAAAAATTTAGCCAGG - Intergenic
1121652427 14:95568968-95568990 AAATTCTAAGAGATAAACCCCGG + Intergenic
1124459970 15:29880272-29880294 AAATTTAAACAGATTAACTGAGG + Intronic
1126435060 15:48628557-48628579 AAATTCACACAGAAGGAGCCTGG - Intronic
1129640522 15:77372466-77372488 AGATTCAAACAGATTGAGGATGG - Intronic
1131308133 15:91264001-91264023 AAATGCACACAGACTGTCCCAGG + Intronic
1134848887 16:17464329-17464351 AAATACAAACAGAATTAGCCAGG + Intronic
1135283605 16:21173927-21173949 TATTTTAAACAGACTGACCCAGG + Intronic
1136060889 16:27725706-27725728 AAAGGCAAACAGATGGACCATGG - Intronic
1136301437 16:29337060-29337082 ACATTCAAACAGATGGTGCCAGG + Intergenic
1136936918 16:34477905-34477927 AAATTAAAACACAATGACCCAGG - Intergenic
1136962901 16:34870665-34870687 AAATTAAAACACAATGACCCAGG + Intergenic
1137345251 16:47651876-47651898 AAAATCAAAGAAATTGCCCCAGG - Intronic
1138029461 16:53548495-53548517 AAATTCTAGGAGGTTGACCCTGG + Intergenic
1139370577 16:66466724-66466746 AAATACAAAAAAATTTACCCGGG - Intronic
1141868422 16:86767461-86767483 AAATTGAAACACATAGACTCTGG + Intergenic
1142718521 17:1761556-1761578 AAATACAAACAAAATTACCCAGG - Intergenic
1144722051 17:17477756-17477778 CAATTCAAAAAGATTGAGACGGG + Intronic
1149542335 17:57477047-57477069 AAATTCTACCAAATTGAGCCTGG + Intronic
1151945309 17:77316382-77316404 AAATCCAAACATTTTGGCCCAGG - Intronic
1152872060 17:82760172-82760194 AACATCAAACAAAATGACCCAGG - Intronic
1155118165 18:22791123-22791145 AAATTCAAACAGGCACACCCTGG - Intergenic
1156190987 18:34720155-34720177 AAAGTCAAGCAGGTGGACCCAGG + Intronic
1164778771 19:30875656-30875678 AAGCTCACACAGAGTGACCCAGG + Intergenic
925042735 2:746033-746055 AAATTCATAAAAACTGACCCAGG - Intergenic
926049224 2:9732568-9732590 AAATTCAAACAAAATGGACCAGG - Intergenic
926385177 2:12328678-12328700 AAACACAAACAGACTGACACAGG + Intergenic
927005738 2:18846518-18846540 AAATCCAAACAGTTTGATTCTGG - Intergenic
927970411 2:27302494-27302516 AAAATCAAGCAGATTAAGCCAGG + Intronic
928214083 2:29346795-29346817 AGATTCTGACAGATGGACCCAGG - Intronic
930532231 2:52603463-52603485 AAATTCAAAAAAAATTACCCAGG + Intergenic
938325764 2:130399367-130399389 AAATTCAACCAAATTAACACTGG + Intergenic
938423193 2:131160828-131160850 AAATTCAACCAAATTAACACTGG - Intronic
939910671 2:147978483-147978505 AAGTTCAGAAAGCTTGACCCAGG + Intronic
941103854 2:161329991-161330013 ATATTCAAACAAACTGACACAGG - Intronic
941581255 2:167298704-167298726 AAATCCAAAGTGATTGACCTTGG - Intergenic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
945555677 2:211272335-211272357 ATATTCATATAGATTGACACTGG - Intergenic
945741426 2:213667582-213667604 AAAGTCAAAGAGATTGACGTTGG + Intronic
946181922 2:217954040-217954062 AGATTCAAACAGAATGGTCCTGG + Intronic
946777071 2:223154189-223154211 AACTTCAAACATACTGACCTTGG + Intronic
947066928 2:226237466-226237488 AAATTCAAACAGATTGCAAGAGG - Intergenic
947671976 2:231943149-231943171 AAATACAAAAAGAATTACCCAGG - Intergenic
949020265 2:241737127-241737149 AAATACAAAAAGAATGAGCCGGG - Intronic
1169116204 20:3067650-3067672 AAATACAAACAAATTTAGCCGGG - Intergenic
1169179348 20:3549649-3549671 AAATTCAAACCATTTGACCTTGG - Intronic
1172221738 20:33278851-33278873 AAGATCAAACCCATTGACCCAGG - Intronic
1172939083 20:38642405-38642427 AAACTCAAACAGGAAGACCCGGG - Intronic
1175031757 20:55961751-55961773 TAAATCACACAGATTGACCCAGG + Intergenic
1176518701 21:7807999-7808021 AAATTCAGACTGATTGGCTCTGG + Intergenic
1178652729 21:34438012-34438034 AAATTCAGACTGATTGGCTCTGG + Intergenic
1181884852 22:26012526-26012548 AAATGCAAACACATTAACCATGG + Intronic
949333202 3:2945287-2945309 AAATTCAGACAGATTCCTCCGGG - Intronic
949988876 3:9560764-9560786 AAATTCAAAAAAAATTACCCAGG + Intergenic
951118246 3:18891205-18891227 GAATTCAACCAGATTTATCCAGG + Intergenic
951412298 3:22379802-22379824 AAATACAAACTGCTGGACCCTGG + Intergenic
952228478 3:31404003-31404025 ACATTCAAGCATATTGACCTTGG - Intergenic
952371957 3:32731371-32731393 AAATTCATATTGATTGACTCCGG + Intronic
952923444 3:38304546-38304568 AAATTCAAAAAAATTTAGCCAGG - Intronic
953455710 3:43040352-43040374 TAATTCAAACAGTGTGACTCTGG - Intronic
953817524 3:46171968-46171990 AAATTCAAAAAAATTTAGCCAGG - Intronic
954936196 3:54329083-54329105 AAAGTCAATCAAAGTGACCCTGG - Intronic
955112447 3:55962150-55962172 AAATTCAGAAAGAGTTACCCAGG - Intronic
958724181 3:97883506-97883528 AAAATCAAACAGATTTAATCTGG + Intronic
960394955 3:117125590-117125612 AAGTTCAAACTCATTGTCCCTGG - Intronic
960928179 3:122816962-122816984 AAAGGAAAACAGAATGACCCTGG + Intronic
963167912 3:142224247-142224269 AAATACAAACAAATTTAGCCAGG + Intronic
963349361 3:144134008-144134030 ACATTCAAACTGTTTGACCTTGG - Intergenic
963450139 3:145469247-145469269 GAATTCAAACAGACTGACATAGG - Intergenic
964497594 3:157310088-157310110 AAATTCAATCAAATTCAGCCAGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967487632 3:190052285-190052307 AAATTAGAACATATGGACCCAGG - Intronic
967630840 3:191741663-191741685 ATATTAAAACAGATTGTACCTGG - Intergenic
969321554 4:6416052-6416074 AAATCCAAATAGAAAGACCCAGG - Intronic
970887451 4:21002884-21002906 AAATTGAAACATTTTAACCCTGG + Intronic
971662628 4:29439743-29439765 CATTTCAAATAGATTGATCCTGG + Intergenic
972248836 4:37277252-37277274 AAATACAAAGAGATTCACACCGG - Intronic
975857385 4:78639116-78639138 AAATTCAAACCCAGGGACCCTGG - Intergenic
975936791 4:79591222-79591244 GAATACAAGCAGATTGACCAGGG + Intergenic
979215200 4:118155290-118155312 AACTACACACAGATTGGCCCTGG - Intronic
980770616 4:137367839-137367861 AAATTGAAACAGAGAGATCCTGG + Intergenic
981790426 4:148530096-148530118 AAATACAAACACATTGGGCCGGG - Intergenic
982224284 4:153152124-153152146 AGATTCAAAGAGATTGACGAGGG - Intergenic
983706574 4:170667393-170667415 AAATTTAAACATATTTCCCCTGG - Intergenic
984485577 4:180364741-180364763 AAATGCAAATGGATGGACCCTGG - Intergenic
984576071 4:181449624-181449646 AAATACAAAAAAATTTACCCGGG + Intergenic
985690359 5:1306462-1306484 AAATTCAAAAAAATTGAGCCAGG - Intergenic
987609838 5:20188978-20189000 AAAATCAAACAGCTGGACTCAGG - Intronic
990577853 5:57140583-57140605 AAATACAAAAAAATTTACCCAGG - Intergenic
991170009 5:63613872-63613894 AAAGTCAATCACATTGACCAAGG - Intergenic
991513863 5:67412133-67412155 AAATAGAAACACATTGACTCTGG - Intergenic
992954742 5:81895945-81895967 AAATTCAAACAGAAGGGTCCAGG - Intergenic
993182129 5:84566693-84566715 ATTTTTAAACAGAGTGACCCAGG - Intergenic
993364528 5:87019786-87019808 CAATTAAAGCAGATTGTCCCTGG - Intergenic
994973073 5:106768129-106768151 AAATTCAAAGAGGTAGACCATGG + Intergenic
995379969 5:111520892-111520914 AAATTTAAACAGATAAAACCAGG + Intergenic
995413064 5:111880102-111880124 AAATTCAAACCTATGCACCCTGG - Intronic
995588432 5:113673309-113673331 AAATTTCAATACATTGACCCTGG - Intergenic
997154347 5:131537253-131537275 TAATTCAGACAGATTTGCCCAGG - Intronic
1000454670 5:161435044-161435066 ATGTTCATACACATTGACCCAGG + Intronic
1000966117 5:167658702-167658724 AAATTGTAACTGATTGACCTAGG + Intronic
1003237601 6:4310658-4310680 CAATTCAAAAAGTTTCACCCTGG + Intergenic
1005253551 6:23974743-23974765 AAAATCAAATAGATTGAACTCGG + Intergenic
1005281621 6:24280695-24280717 AAATTCAAAAAAATTTACCTGGG - Intronic
1006533149 6:34674582-34674604 GAATTGAAACAGATTGCCTCTGG + Intronic
1008033686 6:46724121-46724143 AATTTTAAATAGATTGAACCGGG - Intronic
1009267330 6:61572155-61572177 AAATACAAACGGATTGTCCAAGG + Intergenic
1009468180 6:63999897-63999919 AAATTCAAACAATATTACCCTGG + Intronic
1009821465 6:68807397-68807419 AAATACAAACAAAATTACCCGGG - Intronic
1011914104 6:92480864-92480886 AAATTCTAGCAGATTGAATCTGG - Intergenic
1012101340 6:95089676-95089698 AAATGCAAACAGATTTTTCCAGG - Intergenic
1016409331 6:143765509-143765531 AAACTCGAACAGACTGTCCCTGG + Exonic
1020938488 7:14499985-14500007 AAATTCAAATAAGTTGAACCAGG + Intronic
1021392360 7:20108818-20108840 AAATTCAAATAGAATGACTTGGG - Intergenic
1022333479 7:29401342-29401364 AAATTCATACAGTCAGACCCAGG + Intronic
1023555309 7:41416084-41416106 AAATTCAAACATGTTGACACTGG - Intergenic
1023730430 7:43186506-43186528 AAATACAAAAAAATTTACCCAGG + Intronic
1024442983 7:49443126-49443148 AATTTCTAAGATATTGACCCTGG + Intergenic
1024790668 7:52961911-52961933 AAATACCTACAGATTGACACAGG - Intergenic
1029280374 7:99431576-99431598 AAATACAAACAAAATGAGCCAGG + Intronic
1030096356 7:105904046-105904068 TAATCCTAACAGATGGACCCAGG - Intronic
1030465538 7:109898829-109898851 AAATTCAAAGAGATTCCTCCAGG - Intergenic
1031503173 7:122547131-122547153 AAATTAAAACATATTAACCCTGG + Intronic
1032490453 7:132320370-132320392 AAATTTAGACAGAGAGACCCGGG - Intronic
1036277479 8:7368196-7368218 AAATCCAATCAGATTGAACAGGG - Intronic
1036437425 8:8747559-8747581 AAATTCTAACAAATAGAGCCAGG + Intergenic
1036622803 8:10436744-10436766 AAACTCAAAACGATTGACCATGG - Intergenic
1037028364 8:14069282-14069304 AAATTAAAACAGAATGATACTGG + Intergenic
1038001394 8:23394765-23394787 AAATTGAAACACATTGAAACAGG + Intronic
1038291769 8:26256162-26256184 AAATTCAAACAGATTGACCCAGG - Intergenic
1038974366 8:32676507-32676529 AAATTTAAACAGATTGCCAAGGG - Intronic
1039271669 8:35888145-35888167 AAACTCAAAAAGATTCACTCAGG + Intergenic
1039787167 8:40844018-40844040 AAAGTCCAACTGATAGACCCTGG + Intronic
1039960141 8:42240000-42240022 AAATTCAAAAAGATTTTTCCTGG - Intergenic
1041692518 8:60702916-60702938 ATATTCCAGCAGATTGGCCCAGG + Intronic
1042201367 8:66282118-66282140 TAATTCACACACATGGACCCAGG + Intergenic
1047020354 8:120769127-120769149 AATTTCAAATAGAGGGACCCTGG - Intronic
1048921218 8:139231737-139231759 AAGTTCAAACAGATTGTCAAAGG + Intergenic
1049063486 8:140294766-140294788 AAATACAAACAAATTTAGCCGGG - Intronic
1049379210 8:142303614-142303636 AAATACAGACAGATGAACCCCGG + Intronic
1051286166 9:15499101-15499123 AAATTCAAAAAGACTGACTCAGG + Intronic
1057960350 9:99449834-99449856 ATATTCAGAAAGAATGACCCAGG - Intergenic
1062039798 9:134399035-134399057 AAATCCACACAGACTGAGCCTGG - Intronic
1186764778 X:12759600-12759622 AGCTTCAAACAGCTGGACCCTGG + Intergenic
1186950075 X:14614749-14614771 AAATTCCAACAAGTTGCCCCTGG - Intronic
1187854706 X:23625584-23625606 AAATTGAAACAGTTTTCCCCTGG - Intergenic
1187860084 X:23673593-23673615 AAATACAAACAAAATTACCCGGG + Intronic
1189281626 X:39823167-39823189 AAATTGAAACAATTTGAACCTGG + Intergenic
1190390201 X:49923666-49923688 AAATCAAAACAGACTGTCCCAGG + Exonic
1192786271 X:74338964-74338986 TAATTCAAAGAGATTTACACTGG - Intergenic
1195625813 X:107005008-107005030 AAACTCAAACAGAAAAACCCAGG + Intergenic
1196542064 X:116921889-116921911 GAATTCAAACACATTGCCCGGGG - Intergenic
1196603558 X:117629050-117629072 AAATTCACAAAGTATGACCCAGG + Intergenic
1196708937 X:118742666-118742688 AAAATCAAACAGCTTGAAACGGG - Intronic
1197109899 X:122759803-122759825 AAATTTAATAAGATTGAACCAGG - Intergenic
1201798723 Y:17929292-17929314 AACTTCCAACAGATACACCCAGG - Intergenic
1201802830 Y:17976665-17976687 AACTTCCAACAGATACACCCAGG + Intergenic
1202360030 Y:24097937-24097959 AAATTCCAACAGATACACCCAGG - Intergenic
1202510747 Y:25572177-25572199 AAATTCCAACAGATACACCCAGG + Intergenic