ID: 1038292650

View in Genome Browser
Species Human (GRCh38)
Location 8:26263718-26263740
Sequence GGGGCCCAGTTTCCCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038292644_1038292650 14 Left 1038292644 8:26263681-26263703 CCAAAACACAGGAACCAATCACA No data
Right 1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG No data
1038292645_1038292650 0 Left 1038292645 8:26263695-26263717 CCAATCACAGCAACCAACTAAAA No data
Right 1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038292650 Original CRISPR GGGGCCCAGTTTCCCCATGC TGG Intergenic
No off target data available for this crispr