ID: 1038301510

View in Genome Browser
Species Human (GRCh38)
Location 8:26354655-26354677
Sequence AGGTACACACAGTGGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038301510_1038301515 6 Left 1038301510 8:26354655-26354677 CCATGTGCCCACTGTGTGTACCT 0: 1
1: 0
2: 0
3: 17
4: 238
Right 1038301515 8:26354684-26354706 CATATCCTGTAGCCTAGGAGAGG 0: 1
1: 0
2: 2
3: 6
4: 115
1038301510_1038301514 1 Left 1038301510 8:26354655-26354677 CCATGTGCCCACTGTGTGTACCT 0: 1
1: 0
2: 0
3: 17
4: 238
Right 1038301514 8:26354679-26354701 TTGCACATATCCTGTAGCCTAGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038301510 Original CRISPR AGGTACACACAGTGGGCACA TGG (reversed) Intronic
900161251 1:1225029-1225051 AGGGACACAGACTGGGGACACGG + Intronic
902570788 1:17345939-17345961 AGGGACACACAGGTGGCTCAGGG - Intronic
903663067 1:24990437-24990459 AGGTCCACGCAGTGAGCCCAGGG + Intergenic
904776553 1:32911877-32911899 GGGTACACACATTTGGAACATGG - Intergenic
906648729 1:47495075-47495097 AGGCACCAACACTGGGCACAAGG + Intergenic
906901881 1:49844413-49844435 AGGGAAAAACAGTTGGCACAAGG - Intronic
907550156 1:55298386-55298408 AGGGACACACAGAGGGCTCTGGG + Intergenic
912231731 1:107801075-107801097 AAGAACATACAGTGGGCAAAAGG - Intronic
916448173 1:164893216-164893238 AGGGAAAGAAAGTGGGCACAGGG - Intronic
917648009 1:177047797-177047819 AGGTACAGAAAGTGGAAACATGG + Intronic
917843039 1:178998033-178998055 AGAGACACAAAGTGAGCACATGG + Intergenic
918512584 1:185327745-185327767 AGGAACCCACAGTGGGCATGGGG + Intergenic
920100816 1:203515941-203515963 CGGTGCACAAAGTGGCCACAGGG - Intergenic
923784741 1:237055876-237055898 AGGTCCACACAGAGGGAAGATGG + Intronic
924441256 1:244087302-244087324 AGACACACACAGAGGGCAGACGG + Intergenic
1062846943 10:714933-714955 CAGTCCACACAGTGAGCACAGGG + Intergenic
1064002065 10:11672122-11672144 AGGGACACGAAGTGAGCACATGG + Intergenic
1064425007 10:15222786-15222808 AGCGGCACACAGTGGGCACGTGG + Intronic
1067047596 10:42993258-42993280 ATGTACACAGAGTGGGGAGATGG - Intergenic
1068322809 10:55441899-55441921 GGGCACACACAGAGAGCACAAGG + Intronic
1068748693 10:60566007-60566029 AGAGACACAAAGTGAGCACATGG - Intronic
1069823308 10:71240469-71240491 AGGCACAGGCCGTGGGCACAGGG + Intronic
1070552174 10:77498476-77498498 AGATGCAAACAGTTGGCACAAGG + Intronic
1071564140 10:86662917-86662939 AGGCTCCCACAGTGAGCACATGG - Intronic
1073384625 10:103114510-103114532 AGGTGCACACTGTTGGCCCATGG - Intronic
1073890069 10:108091025-108091047 CAGTACTCACAGTGGGCACGGGG + Intergenic
1077337700 11:2012794-2012816 AGAAACACACAGGGGGCCCAGGG - Intergenic
1077418494 11:2437000-2437022 AGCTACACCCTGTGGGCTCATGG - Intergenic
1077469314 11:2749411-2749433 AGGGTCACACAGTTGGCACCAGG - Intronic
1079903842 11:26221425-26221447 GGTTACTCACAGTGGCCACAGGG + Intergenic
1083154917 11:60816597-60816619 GGCCACACACAGTGGGCAAACGG - Intergenic
1083506577 11:63163486-63163508 AGGTACACTCACTGGGCTGAGGG + Intronic
1084212955 11:67632261-67632283 AGGTGTACACAGTGGGCGGAAGG - Intronic
1085649072 11:78250891-78250913 AGCTAAACACAGGGTGCACATGG + Intronic
1089869938 11:121663539-121663561 AGGTACTTACAGAGGGCACTGGG - Intergenic
1090429552 11:126634658-126634680 AGGTGCACACAGCAGGTACAAGG - Intronic
1091302643 11:134517111-134517133 AGGTGTACCCAGTGGGCACCGGG - Intergenic
1202820684 11_KI270721v1_random:67976-67998 AGAAACACACAGGGGGCCCAGGG - Intergenic
1092052456 12:5481244-5481266 AGGGACTCACAGTGGCCAAAGGG + Intronic
1092439218 12:8483159-8483181 AGGTACACATAGTGTGGCCATGG + Intergenic
1092714345 12:11373063-11373085 AGCTAGACACAGAGGGCTCATGG + Intronic
1096272052 12:50173279-50173301 GGGTACACAGAGTAGGAACAAGG - Intergenic
1102735118 12:115152241-115152263 AGTTACACACAGCCTGCACATGG - Intergenic
1103615028 12:122146361-122146383 AGGGACACGCATGGGGCACATGG + Exonic
1103961434 12:124611461-124611483 GGGAACACCCAGTGGGCACCAGG - Intergenic
1104478069 12:129086449-129086471 AGCTAAATACAGTGGACACATGG - Intronic
1104967739 12:132516740-132516762 AGGTTCACACAGTGAGCAGCTGG + Intronic
1105998345 13:25694385-25694407 AGGTACACAGATTTGGCCCAGGG - Intronic
1106100301 13:26689512-26689534 AGGTACACACCGTGTGCATCAGG - Intergenic
1106359688 13:29019200-29019222 AGGCACACACAGTGGCTGCAGGG + Intronic
1106604651 13:31216652-31216674 AGCTAAACACAGTGTACACATGG - Intronic
1108832627 13:54498722-54498744 GGGTACAGACATTGGGCAAACGG - Intergenic
1112938039 13:104825254-104825276 ACATACACAAAGTGGCCACAGGG - Intergenic
1113124146 13:106957794-106957816 GGGAAGACACAGTGGGCACAAGG + Intergenic
1113569246 13:111342166-111342188 ATGCACACAGAGTGGGCTCATGG - Intronic
1116764498 14:49053597-49053619 ATGTATACACAGTGGGAATATGG - Intergenic
1118249816 14:64148605-64148627 AGGCACAGTCAGTGGGCACGTGG - Intronic
1119992492 14:79214979-79215001 AGGGACACACTGTGAGCTCAAGG + Intronic
1120656115 14:87191875-87191897 AAGTGCACACAGCTGGCACATGG + Intergenic
1121517417 14:94561745-94561767 AGGGACACACAGCTGGTACAGGG + Intronic
1123869645 15:24557586-24557608 AGGCACACAAAGAGGGCAGAGGG + Intergenic
1124367290 15:29081134-29081156 GGTTTCATACAGTGGGCACATGG + Intronic
1124422235 15:29533017-29533039 TGGAACACACACTGAGCACATGG - Intronic
1126880093 15:53085164-53085186 AGGTGGAAAGAGTGGGCACAGGG - Intergenic
1127304400 15:57690778-57690800 GGGTGCTCACAGTGGACACATGG - Intronic
1128213498 15:65918086-65918108 CAGCACACACTGTGGGCACAGGG + Exonic
1128308584 15:66616291-66616313 AGGACCACACAGTTGGCACAAGG - Intronic
1129274849 15:74438280-74438302 AGATAGTCACAGTGGGCACATGG - Intergenic
1131098460 15:89670428-89670450 AGATCCAAACAGTTGGCACAGGG - Intronic
1132074441 15:98808453-98808475 AGGTACACACAGTAATCTCAAGG - Intronic
1134610287 16:15602804-15602826 CGGTACACACAGTGAACACTGGG + Intronic
1135698551 16:24611328-24611350 ACGTACACACAGCGGGAACTGGG - Intergenic
1135834013 16:25806481-25806503 AAGTGCACACGGTTGGCACAGGG - Intronic
1136613233 16:31379917-31379939 AGGGACCCACATGGGGCACAAGG - Intronic
1137572819 16:49577964-49577986 AGGCACACACTGTGGGCAGGTGG + Intronic
1139614764 16:68082316-68082338 AGGTAGCCACAGGGGACACAAGG - Intergenic
1140832234 16:78762580-78762602 CAGTACTAACAGTGGGCACAGGG + Intronic
1141166651 16:81665303-81665325 AGGTCCACTAAGTGGCCACAGGG + Intronic
1142134272 16:88444474-88444496 AGGTTCACGCAGTGGGGAGAGGG + Intergenic
1142276980 16:89123939-89123961 AGATACACGCAGTGTGCACACGG + Intronic
1143296508 17:5875455-5875477 CAGTACACGCAATGGGCACATGG - Intronic
1145166298 17:20615281-20615303 TGGCACACACGGTGGGCAGAGGG + Intergenic
1145993486 17:29092834-29092856 AGGTATCCACAGAGAGCACACGG - Exonic
1146737052 17:35247446-35247468 GAGTCCACACAGTGGGCAGATGG - Intronic
1147176385 17:38658650-38658672 TGGAACCCACAGTGGCCACAGGG + Intergenic
1147686079 17:42287715-42287737 AGGGCCACACAGTAGGCACGTGG - Intronic
1147860810 17:43521882-43521904 AGCTCTACACAGTGGGCAGACGG - Intronic
1147911315 17:43857905-43857927 AGCTCCAGACAATGGGCACAGGG - Intronic
1150473786 17:65459082-65459104 AGGTACACACATTGTTCACAGGG + Intergenic
1150589127 17:66546570-66546592 AGGCACACACAGAGGGAAGATGG - Intronic
1151426723 17:74035497-74035519 TGGTACTCACAGGGGCCACACGG + Intergenic
1152722290 17:81928945-81928967 AGGTCCACACAGCGGGGACCTGG + Intergenic
1203167084 17_GL000205v2_random:107283-107305 ATGTGCACACAGTGTGCCCAAGG + Intergenic
1154250243 18:12738253-12738275 AGGGACACACACGGGGCACGTGG - Intergenic
1158232101 18:55268446-55268468 AGCTACAGACAGAGGTCACATGG - Intronic
1158645466 18:59241831-59241853 AGCTAAACACTGAGGGCACATGG + Intergenic
1159039299 18:63308359-63308381 AGGTTCTCACAGTGGGAGCAAGG - Intronic
1161951675 19:7471125-7471147 GGGTACACACCCTGGGCACAGGG + Exonic
1162343180 19:10104855-10104877 AGGTACACACAGTTGACACCCGG + Intergenic
1163115265 19:15185247-15185269 AGGTACACACCCTGGACACCAGG + Exonic
1164124296 19:22297317-22297339 AAGTGCACACAGTGTGCCCAAGG + Intronic
1164133291 19:22385507-22385529 AGGTAAACACTGGGTGCACATGG - Intergenic
1164569054 19:29356287-29356309 ATGTAGACACCATGGGCACAGGG - Intergenic
1164725050 19:30460660-30460682 CTGCACACACAGTGGCCACATGG - Intronic
1164949744 19:32327117-32327139 AGGTACACACTGCGTGCACCCGG + Intergenic
1165441929 19:35833387-35833409 AGGACTCCACAGTGGGCACATGG + Intronic
1166052436 19:40268308-40268330 AAGTACCCACTGTGGGCCCAGGG + Intronic
1167035613 19:46993567-46993589 GGGGACAGACAGAGGGCACAGGG - Intronic
1167135261 19:47611825-47611847 GGGTACGCAGTGTGGGCACAGGG + Intronic
1168647084 19:58066467-58066489 AGGAAAAAACAGTTGGCACAAGG - Intronic
925383030 2:3440630-3440652 AGGTACACAGACTGGGAAGAAGG - Intronic
926821578 2:16857185-16857207 ATTTAGACACAGTGGGTACATGG + Intergenic
927915747 2:26935117-26935139 ATGTACAGACAAGGGGCACACGG - Intronic
928450214 2:31371816-31371838 TAGTCCACACAGTGGGCCCAAGG + Intronic
930702635 2:54474411-54474433 AGGGTCACAAAGTGGGCCCATGG - Intronic
933833306 2:86227390-86227412 AGGTACACACTGTGGGAATGGGG + Intronic
935081764 2:99804891-99804913 AGGTATACAGAGTGGGAAAATGG + Intronic
935240283 2:101171921-101171943 AGGTTCTCATAGTGGGGACAAGG - Intronic
936282254 2:111152325-111152347 AGGGAGACACTGTGGGCACCAGG - Intronic
937699690 2:124850382-124850404 AGGGACACACAGAGGGAAGAGGG + Intronic
938624736 2:133095927-133095949 TTGTACACACGGTGGACACATGG + Intronic
938987404 2:136591573-136591595 AGGGACACAAAGTGCACACATGG - Intergenic
939271468 2:139945233-139945255 AAGCAAACACAGTGGTCACAGGG - Intergenic
940778323 2:157907196-157907218 ATGTACACATAGTGGGGAGAGGG + Intronic
943726922 2:191261485-191261507 ACGGACACACAGTGTGAACATGG - Intronic
945423506 2:209669276-209669298 AGGTACACTCAATGTTCACATGG - Intronic
947632587 2:231663603-231663625 AGGTGTCAACAGTGGGCACACGG - Intergenic
948403381 2:237700689-237700711 AGGGACACCCAGTGGGCCAATGG - Intronic
1170897168 20:20425942-20425964 AGCTACACTAAGTGGACACAAGG + Intronic
1172106078 20:32518045-32518067 AGGGACACACAGTGGGGAACAGG + Intronic
1174308706 20:49633690-49633712 AAGTACACACTGTTGGCAAAAGG - Exonic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175910203 20:62401674-62401696 AGGTGCACACAGACGCCACACGG + Intronic
1176404675 21:6351816-6351838 ATGTGCACACAGTGTGCCCAAGG - Intergenic
1176432482 21:6637288-6637310 ATGTGCACACAGTGTGCCCAAGG + Intergenic
1181009968 22:20034543-20034565 AGGTCCACACTGGGGGTACAAGG - Intronic
1181311827 22:21949069-21949091 ATGTGCAGATAGTGGGCACAAGG - Intronic
1181393546 22:22601347-22601369 ATTCACACACAGTCGGCACATGG - Intergenic
1182375196 22:29841764-29841786 ATCCACACACACTGGGCACAAGG + Intergenic
1182509390 22:30808173-30808195 AGGTATACACAGAAGACACAGGG + Intronic
1183265652 22:36823641-36823663 AGGATCACACAGTGGGCAAGTGG - Intergenic
1184430577 22:44439719-44439741 AGGTGCACAGGGTGGGCATATGG - Intergenic
1184478147 22:44732390-44732412 AGGTGGGCACAGTGGGCAGAGGG + Exonic
1184812097 22:46843022-46843044 AGGTACGCACAGTGTGCTCGAGG - Intronic
1184924437 22:47626986-47627008 GGGTACACAGAGGGGACACACGG + Intergenic
1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG + Intronic
950118645 3:10467500-10467522 TGGCAGACACAGTTGGCACATGG + Intronic
950667729 3:14507372-14507394 AGGGCCACACAGTGGGCACGGGG - Intronic
953105896 3:39878355-39878377 AGTGCCAGACAGTGGGCACAGGG - Intronic
953657430 3:44864769-44864791 AGGTAGACACAGCAGGTACATGG - Intronic
954879598 3:53824311-53824333 AGGTTCATACACAGGGCACAGGG - Intronic
955245466 3:57220841-57220863 AAGTCCTCATAGTGGGCACAAGG + Intronic
956530952 3:70218047-70218069 GGGCACACAGAGTGGGCAAAAGG - Intergenic
960974472 3:123161288-123161310 AGGTAAAGAGAGTTGGCACAGGG - Intronic
961076494 3:123987370-123987392 AGGCACAGACAGTGGACAGAGGG - Intronic
962209881 3:133468557-133468579 AGCTACACGGAGTGGTCACAGGG - Intronic
963574948 3:147048409-147048431 AGGCAGACACAGGAGGCACAAGG + Intergenic
966314854 3:178633570-178633592 GGCTGCACACAGTGGTCACAGGG + Intronic
966695911 3:182790867-182790889 ATGTGCACACAGTGTGCACATGG - Intergenic
966919544 3:184602774-184602796 AGGAACACAGAGAGGGAACAAGG - Intronic
967143978 3:186590337-186590359 ACTTACACACAGTAGGCACCTGG - Intronic
968669713 4:1842570-1842592 TGGTGCACACAGTGTGCACCTGG - Intronic
968903162 4:3440548-3440570 TGGTACACACAGCTGGCACTGGG - Intergenic
969208590 4:5668515-5668537 AGGTACACACTCAGGGCTCAGGG - Intronic
969488518 4:7485751-7485773 AGGTGCCCACTGTGGGCCCAGGG + Intronic
970285206 4:14505631-14505653 AGGCACACATAGTGGTCAAATGG - Intergenic
972260288 4:37401245-37401267 AGGCACACCCAGGGGGCTCATGG - Intronic
977539314 4:98297452-98297474 AGATACACAAAGTAAGCACAAGG - Intronic
977808559 4:101332799-101332821 ATGGACACACAGTTGGCATATGG + Intronic
985053174 4:186013040-186013062 AGGTTCACACTCTGGGGACATGG + Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
987147279 5:15004715-15004737 AGGTTCACACAGTGGTCAAGTGG + Intergenic
988615201 5:32768570-32768592 AGGGTCACACAGCTGGCACACGG - Intronic
996595013 5:125190813-125190835 AGGAACAGACAGTGGACACAGGG - Intergenic
996660394 5:125996024-125996046 AGGGACACAAAGTAAGCACATGG - Intergenic
997429338 5:133826719-133826741 AGTCACACACACTGGGCTCAGGG + Intergenic
998814562 5:145999853-145999875 AGAGACACAAAGTGAGCACATGG + Intronic
998997301 5:147879654-147879676 AGGAAGACAGTGTGGGCACATGG + Intronic
999103738 5:149050197-149050219 AGGATCCCACTGTGGGCACAGGG - Intronic
1003127014 6:3363562-3363584 AGGTGCCCACACTGGGCCCAGGG - Intronic
1003598488 6:7496364-7496386 AGCTAAGCACAGTGGACACAAGG + Intergenic
1003646899 6:7920243-7920265 AGATACACAGAGTGGGCAGATGG + Intronic
1003948139 6:11093919-11093941 GGGTACACACGGCGGCCACAAGG - Intergenic
1005768049 6:29034722-29034744 AAGAACACACAATGGGGACAGGG - Intergenic
1005850344 6:29816147-29816169 AGCTGCACACTGTGGGCCCAAGG - Intergenic
1006189249 6:32197449-32197471 AGGCTCACACCGTGGGCACTGGG - Exonic
1006259378 6:32854893-32854915 AAGTCCCCCCAGTGGGCACATGG - Intronic
1006294266 6:33163020-33163042 TGGAAGAGACAGTGGGCACATGG + Exonic
1007093609 6:39199953-39199975 AGATACACACAGTGGGAATAGGG - Intronic
1009573558 6:65421999-65422021 AGAGACACAAAGTGAGCACATGG + Intronic
1009823708 6:68839563-68839585 AGGTACAGACAGAGTCCACATGG - Intronic
1010487687 6:76435104-76435126 AGGTACTCACAGAGAGCAAATGG + Intergenic
1013634764 6:112018724-112018746 GGGTCCACACAGTGAGCAAAAGG - Intergenic
1016236581 6:141875216-141875238 AGGTCCATTCACTGGGCACAGGG + Intergenic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1017546271 6:155454111-155454133 AGAGACACAAAGTGAGCACATGG + Intronic
1018875552 6:167819317-167819339 AGCTACACACTGTGGACACAGGG - Intergenic
1019196119 6:170284011-170284033 AGGTCCACACACTTGGCACCTGG + Exonic
1019358261 7:592140-592162 AGGGTCACACAGTGTGCACGTGG - Intronic
1019569690 7:1705090-1705112 AGGGACACCCAGTGGCCAAAGGG + Intronic
1019593016 7:1845011-1845033 CTGGACTCACAGTGGGCACAGGG + Intronic
1019873271 7:3787421-3787443 AGGAACACAGCGTGTGCACAAGG - Intronic
1020060459 7:5147808-5147830 AGTCACACACTGTGGGCTCAGGG - Intergenic
1020769995 7:12378753-12378775 ATGTACACACAGTAGGAACCAGG - Intronic
1022520850 7:31006080-31006102 GGGAACACACAGTGACCACAGGG - Intergenic
1023392956 7:39728134-39728156 AGGTACAAACAGTCGCCTCAGGG - Intergenic
1024873750 7:53996328-53996350 GGGTCGACACAGTGGGAACAAGG - Intergenic
1025774996 7:64553518-64553540 AAGTGCACACAGTGTGCCCAAGG - Intronic
1025816020 7:64912521-64912543 AAGTGCACACAGTGTGCCCAAGG + Intronic
1026300811 7:69096520-69096542 GTGTACTCACAGTGGGCTCAAGG - Intergenic
1026805592 7:73427819-73427841 AGGTACACAGGCTGTGCACAGGG - Intergenic
1029455156 7:100666332-100666354 ATGTACACCAAGTCGGCACACGG + Intergenic
1031997300 7:128241120-128241142 AGGTGCACACTGCGGGCCCAGGG + Intergenic
1032616362 7:133475959-133475981 AGATATACACTTTGGGCACATGG - Intronic
1033284878 7:140032827-140032849 TGTTACCCACAGTGGGAACAGGG + Intronic
1033629186 7:143140286-143140308 AGGTGCACGAAGTGGGCAGAGGG + Intergenic
1034001883 7:147423459-147423481 AGATACACACAGTGGACAAATGG - Intronic
1034318640 7:150159038-150159060 AGGCACACACCGTGGCAACAAGG + Intergenic
1035983003 8:4393848-4393870 ATGTACACACATGGAGCACACGG + Intronic
1036133653 8:6139373-6139395 AGGTCCAGGCTGTGGGCACAGGG - Intergenic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1040728659 8:50414826-50414848 AGGTTCACAAAGTTGGCAAATGG - Intronic
1044027511 8:87191750-87191772 GGGTCCACACAGTGGGCAGTCGG - Intronic
1044429039 8:92087156-92087178 GGGTACCCAGATTGGGCACAGGG - Intronic
1045054886 8:98360301-98360323 AGTTACACACAGTGTGCAAATGG - Intergenic
1046986390 8:120392709-120392731 AGGTACAGACAATGGGGAAAAGG + Intronic
1047959322 8:129999390-129999412 AGGAACACAGAGTGAGCAAATGG + Intronic
1048266750 8:132994047-132994069 AGTTACCCAGAGTGGGCAGAGGG - Intronic
1049215674 8:141406862-141406884 TTGCACATACAGTGGGCACAGGG - Intronic
1049300675 8:141867804-141867826 TGGTTCACACAGAGGACACAGGG + Intergenic
1049795140 8:144493724-144493746 AGGTACCCAAAGTGAGCCCAGGG - Intronic
1051318662 9:15874441-15874463 AAGTCCACTCAGTGGGCTCAAGG + Intronic
1051663365 9:19445756-19445778 AAGTATTCACAGTGGCCACAAGG - Intronic
1051724784 9:20078008-20078030 AGGGGCACAGGGTGGGCACAGGG + Intergenic
1052862407 9:33445217-33445239 AGGGACACTCAGGGGGCTCAGGG - Intronic
1053274231 9:36771155-36771177 AAGGTCACACAGGGGGCACATGG - Intergenic
1057311872 9:93948066-93948088 AGGAACCCAAAGTGGGCTCAGGG + Intergenic
1059467256 9:114476837-114476859 AGGAAGACACTGTGAGCACAGGG + Intronic
1061218557 9:129235841-129235863 AAGGACACACAGTGGGTGCAGGG + Intergenic
1061350998 9:130064784-130064806 AGGCACACACAGAGGGAAGAAGG + Intronic
1061541276 9:131278848-131278870 AGGTGCCCACAGCCGGCACAGGG + Intergenic
1203439053 Un_GL000195v1:171424-171446 ATGTGCACACAGTGTGCCCAAGG - Intergenic
1189493442 X:41488007-41488029 GGGTTCACACAGTGAACACATGG + Intergenic
1189755896 X:44271013-44271035 AGGTTCACACACTTGGGACAGGG - Intronic
1190340297 X:49290718-49290740 AGGGTCACACAGTGGGCAAGTGG + Intronic
1190740187 X:53283454-53283476 AGGTAGACAAAGTGTGCACATGG + Intronic
1193254483 X:79331047-79331069 AAGTACACACAGTAAGCATAAGG - Intergenic
1193939538 X:87663869-87663891 AGATACAAACAGTGGTCAGAGGG + Intronic
1196187508 X:112760400-112760422 AAGTCCCCACAGTGGGCAGAAGG - Intergenic
1197492361 X:127133782-127133804 AGGTACATACACTGGGAATAAGG + Intergenic
1197869762 X:131053805-131053827 AGGTCCACACAGAGCACACAGGG - Intergenic
1199617572 X:149670107-149670129 AGGTACATAAAGGGTGCACAGGG + Intergenic
1199625071 X:149733142-149733164 AGGTACATAAAGGGTGCACAGGG - Intergenic
1200758786 Y:7016806-7016828 AGGTGCACAGAATGGGCAGAGGG - Intronic