ID: 1038302846

View in Genome Browser
Species Human (GRCh38)
Location 8:26370660-26370682
Sequence ATCTAGTCCATTAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038302846 Original CRISPR ATCTAGTCCATTAGGCAAGA TGG (reversed) Exonic
901688489 1:10957872-10957894 ATCTAGGCCAGGAGGCAGGACGG + Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
910366051 1:86466580-86466602 CTCAAGTGCATAAGGCAAGAAGG - Intergenic
910737177 1:90472757-90472779 ATCTAGTCCAGGAGACAGGATGG + Intergenic
912484723 1:110016931-110016953 ATCTATTCCACAAGGCAAAATGG - Intronic
913185056 1:116363310-116363332 ATAATGTCCATTTGGCAAGAAGG + Intergenic
919818513 1:201457455-201457477 ATTTAGACCATTATGCATGAAGG + Intergenic
924028685 1:239865515-239865537 ATCCAGTCCAGTTAGCAAGAGGG + Intronic
1063199801 10:3776958-3776980 AACAATTCCATTAAGCAAGAAGG - Exonic
1063990578 10:11557712-11557734 CTCTAGTGCATGAGGAAAGAGGG + Intronic
1064354751 10:14606453-14606475 AGATATTACATTAGGCAAGAGGG - Intronic
1072121383 10:92408137-92408159 GTCTAGTCCCTAAGGCAAGAAGG + Intergenic
1080302744 11:30802517-30802539 ATCTAGTCCTTTAGGCATTTTGG - Intergenic
1089872613 11:121689471-121689493 ATCTAGGTCATTGGGCAGGATGG + Intergenic
1090180272 11:124692253-124692275 ATGTAGTACATCAGGCACGAAGG - Intronic
1090528429 11:127562733-127562755 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1098541606 12:71663681-71663703 ACCCAGTCCGTTAGGAAAGAAGG - Exonic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1109786706 13:67185129-67185151 TTGTAGTCCATTAGAAAAGAAGG + Intronic
1111607335 13:90557842-90557864 ATGTAGTCCAACAGGCCAGATGG - Intergenic
1115971200 14:38946587-38946609 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1120506132 14:85355246-85355268 TTATAGTCCAGTAGGAAAGATGG - Intergenic
1127286755 15:57539701-57539723 ATCTATCCCAAAAGGCAAGAAGG - Intronic
1134198137 16:12174950-12174972 ATCTTGTCCCTGAGGTAAGAGGG + Intronic
1134561543 16:15214543-15214565 AGCTAGTCTATTAGGTAAGCTGG - Intergenic
1134922080 16:18126169-18126191 AGCTAGTCTATTAGGTAAGCTGG - Intergenic
1138398164 16:56723698-56723720 AGCCAGTGCAGTAGGCAAGAAGG - Intronic
1145986112 17:29047722-29047744 GTCTGGTCCATGAGCCAAGATGG - Intronic
1153647142 18:7205390-7205412 ATCTAGCACATTAAGCCAGAAGG - Intergenic
1158835653 18:61329088-61329110 AACTGGCCCATTAGGCAAGAAGG - Intergenic
1159864115 18:73684212-73684234 ATTGAGTCCATGAGACAAGAAGG + Intergenic
1165347973 19:35260858-35260880 ATATAGTCCATTAGGCATCAGGG + Intronic
930454301 2:51585355-51585377 ATTTATTCCTTGAGGCAAGATGG - Intergenic
933481853 2:82868134-82868156 GTTTATGCCATTAGGCAAGAAGG + Intergenic
936776155 2:115975821-115975843 ATCTATTACAATAGTCAAGAAGG + Intergenic
938403818 2:131016100-131016122 ATCTAGTCCCAGAAGCAAGAGGG - Intronic
940013595 2:149080448-149080470 ATCTATAACAGTAGGCAAGAAGG + Intronic
942857750 2:180570883-180570905 ATGTAGCCCATTAGCAAAGAAGG + Intergenic
943976422 2:194484382-194484404 ATTTACTCCATTAGACAAGATGG - Intergenic
944787597 2:203089010-203089032 ATCTGGTCCAGTAGGTAATAGGG + Intronic
947205234 2:227654917-227654939 ATCTAAGCCATCAGACAAGAGGG - Intergenic
947270659 2:228330612-228330634 ATCTAGTACATATGGCAAAAGGG - Intergenic
1172734776 20:37118224-37118246 ATCTACTCCATGGGGCAACACGG + Intronic
1173117073 20:40254547-40254569 GTATAGTCAATTACGCAAGATGG + Intergenic
1175812594 20:61866624-61866646 ATCCAGACCCTTTGGCAAGAGGG + Intronic
1178007773 21:28242183-28242205 ACCAAGACCCTTAGGCAAGAAGG - Intergenic
1181528776 22:23504252-23504274 TTCTAGGCTATTAGCCAAGATGG - Intergenic
1181635497 22:24172505-24172527 GTCTTGCCCATGAGGCAAGATGG - Intronic
1184265763 22:43345014-43345036 ATCTTGTGCATTGGGCAACAGGG + Intergenic
949417172 3:3827445-3827467 AGCTACTCCATGAGGCAAGATGG - Intronic
956574725 3:70739565-70739587 ATCAAGTCCCTCAGGCAAGTAGG + Intergenic
957177356 3:76828989-76829011 ATGTAGACCAGAAGGCAAGAAGG - Intronic
957990086 3:87615870-87615892 ATATAGTTAATTAGGCAGGAAGG + Intergenic
958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG + Intergenic
958660193 3:97057264-97057286 ATCTCCTCCATTTGGCAGGATGG - Intronic
965662997 3:171062052-171062074 ATCTAGTGGTTTGGGCAAGATGG - Exonic
965912346 3:173794355-173794377 ATATGGTACATTAGGCATGAAGG - Intronic
973847214 4:54924995-54925017 ATCTATGCCATTAGACAAAAGGG + Intergenic
975319761 4:72996619-72996641 ATACAGTCCCTTAGACAAGAGGG - Intergenic
976535930 4:86217070-86217092 ATCTCATCCATGAGGCAATAAGG + Intronic
976660660 4:87536922-87536944 ATCTGGCCCATCAGACAAGAAGG + Intergenic
984689627 4:182711009-182711031 ATATAGCCCATTAGGAAACAGGG - Intronic
988115506 5:26883837-26883859 ATCTATTTTATAAGGCAAGATGG - Intronic
989354119 5:40522180-40522202 ATCTATTGCATTTGGCAATATGG + Intergenic
992326097 5:75661684-75661706 ATCTAGTCCACTAAGCAGCAGGG - Intronic
1002413187 5:179100759-179100781 ATCTTGTCAATTCTGCAAGAAGG - Intergenic
1004269066 6:14177709-14177731 ATTTAGTGCATTAGGCCAGGTGG - Intergenic
1005273639 6:24192909-24192931 ATCCAGTCCAATAAGCAAAAAGG + Intronic
1008014223 6:46500404-46500426 ATCTTATCTATAAGGCAAGAGGG + Intergenic
1010098178 6:72071767-72071789 ATCTATTCCATTATGAAAGTAGG - Intronic
1010240670 6:73612725-73612747 ATCTAATCAGTTAGGCATGATGG - Intronic
1012208971 6:96496893-96496915 AACTATTCCAATAGGAAAGAGGG - Intergenic
1013661041 6:112297326-112297348 ATATTCTCCATTAGGCAAAAGGG + Intergenic
1016354063 6:143198708-143198730 ATTTAAGCCATTAGGAAAGAGGG + Intronic
1017318195 6:153057251-153057273 ATCTTGACCATTAAGAAAGATGG - Intronic
1018616643 6:165692788-165692810 GTTTATTCCATTAGGAAAGAAGG - Intronic
1019925286 7:4187523-4187545 TCCTAGTTTATTAGGCAAGAAGG + Intronic
1024974094 7:55097275-55097297 ATCCAGGCCATTAGGCAAGGAGG - Intronic
1026344790 7:69464843-69464865 ATATATGCCATTAGGCAGGAAGG + Intergenic
1026873262 7:73865923-73865945 CTCCAGCCCATTAGGGAAGAGGG - Intergenic
1028879996 7:95869519-95869541 TTCTAGTCTCTTAGGAAAGAAGG - Intronic
1029453589 7:100656064-100656086 AGCAAGGCCATTGGGCAAGAAGG - Intronic
1031426363 7:121610361-121610383 ATGTACTTCATTAGGCAAGCTGG - Intergenic
1033148762 7:138894560-138894582 ATCTAGTGCATGAGTGAAGAAGG - Intronic
1037698673 8:21251554-21251576 CTATATTCCAATAGGCAAGAGGG + Intergenic
1038302846 8:26370660-26370682 ATCTAGTCCATTAGGCAAGATGG - Exonic
1039376662 8:37041426-37041448 ATGAAGTCCATCAGGGAAGAAGG + Intergenic
1043586546 8:81776900-81776922 ATCTAGTCTATTGGCCATGAAGG - Intergenic
1044354309 8:91203158-91203180 ATCTAGTCTGTTAGGCATGCTGG + Intronic
1044493852 8:92852630-92852652 ATCTACTCCTTTAAGCAGGAAGG - Intergenic
1048800818 8:138192372-138192394 GTCTAGTTCACCAGGCAAGAAGG - Intronic
1050135393 9:2458113-2458135 ACCTAGTCCTGTAGGCAATATGG - Intergenic
1050616154 9:7403750-7403772 ATCTAGTCCTTGAGTAAAGATGG - Intergenic
1052107013 9:24531264-24531286 TTCTGGTCCATTTGGCAGGAAGG + Intergenic
1052994973 9:34547126-34547148 TTCTAGGCCAGAAGGCAAGAAGG - Intergenic
1056510901 9:87304702-87304724 CTTTAGTCCATTAGTAAAGATGG - Intergenic
1186906521 X:14117009-14117031 CTCTTGGCCATTAGGCAAAAAGG + Intergenic
1199716608 X:150511456-150511478 ATCTAGGCTATGAGACAAGAGGG + Intronic
1199757938 X:150882194-150882216 ACCAAGGCCATTAGGCAGGATGG + Intronic