ID: 1038303816

View in Genome Browser
Species Human (GRCh38)
Location 8:26381571-26381593
Sequence TGGTAGGGATTGGCGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038303816_1038303823 3 Left 1038303816 8:26381571-26381593 CCAGCAGCCGCCAATCCCTACCA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1038303823 8:26381597-26381619 GCGGCTTGAACTCCTGCTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1038303816_1038303824 4 Left 1038303816 8:26381571-26381593 CCAGCAGCCGCCAATCCCTACCA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1038303824 8:26381598-26381620 CGGCTTGAACTCCTGCTTCCGGG 0: 1
1: 0
2: 1
3: 15
4: 336
1038303816_1038303825 13 Left 1038303816 8:26381571-26381593 CCAGCAGCCGCCAATCCCTACCA 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1038303825 8:26381607-26381629 CTCCTGCTTCCGGGTATGACCGG 0: 1
1: 0
2: 1
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038303816 Original CRISPR TGGTAGGGATTGGCGGCTGC TGG (reversed) Intergenic
900990925 1:6097974-6097996 TGGTGGGAAGTGGCAGCTGCGGG + Intronic
901002578 1:6155896-6155918 TGGCACAGATTGGGGGCTGCGGG - Intronic
904754177 1:32759027-32759049 TGGTGGGGAGAGGAGGCTGCTGG + Intronic
906144517 1:43551953-43551975 GGGTAGGGAGTGGCAGCTGCAGG - Intronic
907443125 1:54490543-54490565 AGGGAGGGAGGGGCGGCTGCAGG - Intergenic
909369859 1:74870963-74870985 TTGGAGGGGTTGGGGGCTGCTGG + Intergenic
913596119 1:120378812-120378834 TGGAAGGGTTTGGCGTCTGTTGG - Intergenic
914091159 1:144500164-144500186 TGGAAGGGTTTGGCGTCTGTTGG + Intergenic
914307445 1:146434031-146434053 TGGAAGGGTTTGGCGTCTGTTGG - Intergenic
915489170 1:156242002-156242024 TGGTTGGGAGCTGCGGCTGCTGG - Exonic
915917487 1:159949783-159949805 TCAAAGGGATTGGGGGCTGCTGG + Intergenic
918043567 1:180927717-180927739 TGGTAGGGGGTGGGGGCTGGTGG + Intronic
918098358 1:181352738-181352760 TGGTTGTGATTGGAGGGTGCGGG + Intergenic
922394598 1:225183313-225183335 AGGTAGGTAGTGGTGGCTGCAGG + Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
923469405 1:234277309-234277331 TGGTGTGGTTTGGAGGCTGCTGG + Intronic
1069908390 10:71745578-71745600 TGGTAGGCACTGTGGGCTGCAGG - Intronic
1073582731 10:104682650-104682672 TGGAAGAGGTTGGGGGCTGCTGG + Intronic
1074065415 10:110008407-110008429 GGGTAGGGAGCGGCGGCTGGCGG + Intronic
1076171517 10:128323975-128323997 GGGTGGGGAGTGGGGGCTGCAGG - Intergenic
1077519308 11:3022374-3022396 TGATGGGGATTGCCGGTTGCTGG - Intronic
1077703970 11:4466639-4466661 AGGTAGGCATTGCCTGCTGCTGG - Intergenic
1082177879 11:49082667-49082689 TGGTAGAGATTGGCAGACGCTGG + Intergenic
1084750031 11:71198594-71198616 TGGTAGGGGACGGCGTCTGCGGG - Intronic
1086687839 11:89753193-89753215 TGGTAGAGATTGGCAGACGCTGG - Intergenic
1086718012 11:90086701-90086723 TGGTAGAGATTGGCAGACGCTGG + Intergenic
1093958909 12:25251287-25251309 GGGTCAGAATTGGCGGCTGCGGG - Intergenic
1095339320 12:41069669-41069691 TGGTAGGAATTTGGGACTGCTGG + Intronic
1096647179 12:53045322-53045344 TGGCAGGGATTGGAGGCTCCTGG - Intergenic
1102221632 12:111198750-111198772 GGGGAGGGATTGCAGGCTGCAGG + Intronic
1103191685 12:119006964-119006986 TGCTTGGGATTGGCAGCTGCGGG + Intronic
1110138689 13:72101013-72101035 TGGTTGGGATTGGAGGCCCCAGG - Intergenic
1110983497 13:81934107-81934129 TGGTAGGGGTTGGGGGCTCAGGG + Intergenic
1114390469 14:22302638-22302660 TGTTAGGATTTGGGGGCTGCGGG - Intergenic
1115059137 14:29168980-29169002 AGGTAGGGATTATCAGCTGCAGG + Intergenic
1119400407 14:74358685-74358707 TGGCAGGGATGGCCGGATGCTGG + Exonic
1122328481 14:100897030-100897052 TGGGAGGGATTTGGGGCTGTGGG + Intergenic
1132225966 15:100141655-100141677 TGGCTGGGGTTGGGGGCTGCCGG + Intronic
1133455973 16:5942954-5942976 TGGTAGGGCTTGACTGCTCCAGG + Intergenic
1134845022 16:17432996-17433018 GGGTTGGGATTGGAGGCTGTGGG - Intronic
1138955045 16:61961366-61961388 TGACAGGGATTCGCTGCTGCTGG - Intronic
1139591228 16:67934412-67934434 TGGTAGGTAATGGCCCCTGCAGG + Intronic
1139631716 16:68235563-68235585 TGGGCGGGATTGGCGGCCGGAGG - Intronic
1139917702 16:70438666-70438688 GGGTTGGGGTTGGGGGCTGCCGG + Intronic
1140056052 16:71526680-71526702 TAGTGGGGCTTGGGGGCTGCTGG - Intronic
1142172121 16:88628364-88628386 TGGCAGGGAATGGCGGCCACAGG - Intronic
1142354620 16:89596717-89596739 TGGTGGGGACTGGAGGCTTCTGG - Exonic
1147265379 17:39231461-39231483 TGGTAGGGAGAGGGGGCAGCAGG - Intergenic
1148474938 17:47922223-47922245 GGGTAGGGAATGGCGGTGGCAGG - Intronic
1148737087 17:49870968-49870990 TTGTAGGGATTGAAGGCTCCAGG + Intergenic
1153972703 18:10240875-10240897 TGGTTGGGATTGGGGGTTACTGG + Intergenic
1157519222 18:48334028-48334050 TGATAGGGAATGGGGGCTCCAGG - Intronic
1160259677 18:77280592-77280614 TGGTAGATATTGGTGGGTGCAGG + Intergenic
1161434413 19:4254091-4254113 GGGTAGGGAGTGGAGGATGCAGG + Intronic
1161864698 19:6825360-6825382 TGGTAGAGATTGGCTGCGCCAGG - Exonic
1163116054 19:15189159-15189181 TCGCAGGGGTTGGCGCCTGCCGG + Exonic
1163500495 19:17673403-17673425 TGGCTGGGATTGGTGGCTCCTGG + Intronic
1168137891 19:54363773-54363795 TGGTGGTTATTGGAGGCTGCAGG + Intronic
925604802 2:5648157-5648179 TGGAAGGGTTTGGCGTCTGTTGG - Intergenic
926395746 2:12440672-12440694 TGGTAGACATTGGGCGCTGCTGG - Intergenic
934582072 2:95450713-95450735 TGGTAGAGATTGGCAGACGCTGG - Intergenic
934597378 2:95626001-95626023 TGGTAGAGATTGGCAGACGCTGG + Intergenic
934842510 2:97636993-97637015 TGGTAGAGATTGGCAGACGCTGG - Intergenic
935023027 2:99250015-99250037 TAGTAGGTCTTGGAGGCTGCAGG - Intronic
938094414 2:128452202-128452224 TGGTAGGTCATGGAGGCTGCTGG - Intergenic
938094438 2:128452321-128452343 TGGTAGGTCATGGAGGCTGCTGG - Intergenic
943938154 2:193952636-193952658 TAGTAGGCATTGTAGGCTGCTGG - Intergenic
946422319 2:219571657-219571679 TTTTTGGGATTGGCAGCTGCAGG - Intronic
948789733 2:240371106-240371128 TGGCGGGGCTTGGGGGCTGCAGG - Intergenic
948977693 2:241473538-241473560 CGGTAGGGACTGGCAGCTGCTGG - Intronic
1169884684 20:10385705-10385727 TGGCAGGGTTTGGGGGCTACCGG + Intergenic
1169914809 20:10674147-10674169 TGGAAGGGGTTGGGGGCAGCGGG + Intergenic
1171208955 20:23302433-23302455 TGGTAGGGAGTGGGGGCGGGGGG - Intergenic
1175257416 20:57655687-57655709 TGGGAGTGGTTGGAGGCTGCTGG - Intronic
1175931665 20:62496500-62496522 TGGGAGGGATGGGCGGTTGCGGG + Intergenic
1175990500 20:62786152-62786174 TGGAGGGGCTTGGCGGCTGGTGG - Intergenic
1181383311 22:22524521-22524543 TGCTGGGGACTGGGGGCTGCTGG + Intergenic
1184222489 22:43110051-43110073 TGGGAGGGATTGGGGGCAGGGGG - Intergenic
949300869 3:2582465-2582487 TGGCTGGGATTGGGGGCGGCGGG + Intronic
949856520 3:8466975-8466997 TGGTTGGGATTGGAATCTGCTGG - Intergenic
952834151 3:37590006-37590028 TGTTAGGGGATGGCGGCTGCAGG - Intronic
953472279 3:43177545-43177567 TGGTAGGGATTGGCCAATGGGGG + Intergenic
958733946 3:97988730-97988752 TGGTAGGTATTGGTGTCTGGTGG + Intronic
960964992 3:123098480-123098502 TAGTCGGGAGTGGCTGCTGCAGG - Intronic
960986846 3:123286430-123286452 TGGAAGGGACTGGGGGCTGCTGG - Intronic
961791731 3:129381163-129381185 GGGTGCTGATTGGCGGCTGCAGG + Intergenic
961805755 3:129488116-129488138 GGGTGCTGATTGGCGGCTGCAGG + Intronic
962339136 3:134567244-134567266 TGCTAGGGATTGGCGGCGGAAGG + Intronic
966635035 3:182123621-182123643 TGGTGGGAGTTGGGGGCTGCTGG - Intergenic
968384677 4:125388-125410 AGGCAGGGACTGGCGTCTGCAGG + Intronic
968393686 4:213526-213548 AGGCAGGGACTGGCGTCTGCAGG + Intergenic
968405899 4:338704-338726 AGGCAGGGACTGGCGTCTGCAGG + Intronic
968447652 4:660441-660463 TGGGAGGGATTGTGGGCTGAGGG - Intronic
968550518 4:1221291-1221313 TGGCAAGGATACGCGGCTGCCGG + Intronic
968762713 4:2450802-2450824 TGGTAGGGATGGGCAGCTGGGGG + Intronic
970538598 4:17055341-17055363 TGGTGGGGACTGGTGGCTGGCGG - Intergenic
974716131 4:65670335-65670357 GGGGAGGGACTGACGGCTGCCGG + Exonic
975549482 4:75596525-75596547 TGGTAGGAGTTGGGGGCTGCTGG - Intronic
975590068 4:75990893-75990915 TGGCAGGGATTGCGGGGTGCCGG - Exonic
981394510 4:144231954-144231976 TGGTAGGTACTAGCGGCTGAGGG - Intergenic
985670835 5:1205849-1205871 TGGGAGGGTGTGGGGGCTGCAGG - Intronic
985769177 5:1798327-1798349 AGGTAGGGATTGGATGGTGCTGG - Intergenic
986831644 5:11585990-11586012 TGGGAGGGATGGGTGGCTGGTGG + Intronic
993503870 5:88689486-88689508 AGGTAGGGATTGGATTCTGCAGG + Intergenic
997261197 5:132466641-132466663 GGGCAGGGGTTGGCAGCTGCTGG + Intronic
997967128 5:138366781-138366803 TAGTGGGCATTGGCAGCTGCTGG + Intronic
1002000750 5:176195179-176195201 GGGTAGGGATGGGCGGTTGGCGG - Intergenic
1002253587 5:177943791-177943813 GGGTAGGGATGGGCGGTTGGCGG + Intergenic
1003034189 6:2628711-2628733 TGGTAAGGAGTTGGGGCTGCAGG + Intronic
1010570596 6:77469214-77469236 AGGTAGGGATTGGAGGTTGGGGG + Intergenic
1011198961 6:84813674-84813696 GAGTAGGGATTGGCGGGTGGTGG - Intergenic
1016182114 6:141159817-141159839 TGCTAGGGGTTAGGGGCTGCGGG - Intergenic
1017678643 6:156841055-156841077 TGTTAGGGATTTGCTGCTGGAGG + Intronic
1019104859 6:169659927-169659949 GGGCAGGGATGGGCGGCTGAAGG + Intronic
1019265933 7:117618-117640 TCGGGGGGATCGGCGGCTGCCGG - Intergenic
1023434920 7:40132329-40132351 TGGAAGTGATTTGAGGCTGCTGG + Exonic
1023738773 7:43258847-43258869 TGGTAGGGAATGGCTTCTGTAGG + Intronic
1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG + Exonic
1027218282 7:76198196-76198218 GGGTTGGGGCTGGCGGCTGCAGG - Intergenic
1029275602 7:99402286-99402308 TGGTAGGTAGTGGCAGCTGGGGG - Intronic
1029543987 7:101200815-101200837 TGGAAGTGGTTGGGGGCTGCAGG + Exonic
1033243020 7:139696398-139696420 TTGTAGGGATTGGTGGCGGGGGG - Intronic
1034341789 7:150361923-150361945 TGGAAATGAGTGGCGGCTGCTGG + Intergenic
1034439896 7:151081200-151081222 TGTCAGGGATTGGAGGCGGCTGG + Exonic
1036221178 8:6922817-6922839 GGCCAGGGATTGGGGGCTGCAGG - Intergenic
1037608324 8:20455964-20455986 GGGTAGAGATTTGGGGCTGCGGG - Intergenic
1038303816 8:26381571-26381593 TGGTAGGGATTGGCGGCTGCTGG - Intergenic
1044237363 8:89846331-89846353 TGGTAGGAATTTGAGGCTCCTGG - Intergenic
1044954136 8:97462229-97462251 TGCTGGGGATTGGAGGCTGAGGG - Intergenic
1049436270 8:142587556-142587578 TGGGAGGGAGTGGGGACTGCAGG + Intergenic
1049436289 8:142587605-142587627 TGGGAGGGAGTGGGGACTGCAGG + Intergenic
1050136503 9:2471086-2471108 TGGTAGGCACTGGGGGCTGAGGG + Intergenic
1050741558 9:8826329-8826351 TGGGAGGGATTGTAGGCTGAGGG - Intronic
1053284330 9:36840570-36840592 TCATAGGCAGTGGCGGCTGCAGG + Exonic
1055512661 9:77010957-77010979 TGGTGGGGATTGGGGGGTGGGGG - Intergenic
1058956579 9:109954365-109954387 AGCTAGGGCTTGGGGGCTGCTGG - Intronic
1061876387 9:133546236-133546258 TGGTGGGGAGTGGGGGCTGCAGG + Intronic
1061893039 9:133632810-133632832 TGGGATGGATTGGGAGCTGCTGG - Intergenic
1062071328 9:134556545-134556567 TGGTAGGGAGAAGCGGCTGTGGG - Intergenic
1062382084 9:136291368-136291390 TGGCAGGGAGGGGCTGCTGCAGG - Exonic
1185441286 X:229301-229323 TGGTAGGGGTTGGGAGCTGGGGG + Intergenic
1185913252 X:4005772-4005794 TGGTAGGAACTGGCTGCTGTTGG - Intergenic
1187286907 X:17914459-17914481 TGGTAGGGGTTGGGGGATACAGG - Intergenic
1189133335 X:38523132-38523154 TGCTAGGGATTGGCGGGTGGTGG - Intronic
1190542182 X:51488431-51488453 TGGTAGGGGTTGGAGGATGGAGG + Intergenic
1192429823 X:71104249-71104271 TGGTAGGGAGAGGGGGGTGCTGG + Intronic
1195802575 X:108730337-108730359 TGGTGGGGATTGCCGGCGGGGGG - Intronic