ID: 1038304824

View in Genome Browser
Species Human (GRCh38)
Location 8:26389986-26390008
Sequence GAAAATGTACCCAAGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038304824_1038304825 4 Left 1038304824 8:26389986-26390008 CCAAGCTGCTTGGGTACATTTTC 0: 1
1: 0
2: 0
3: 20
4: 246
Right 1038304825 8:26390013-26390035 ACAAAATTTATTGTAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038304824 Original CRISPR GAAAATGTACCCAAGCAGCT TGG (reversed) Intronic
900488932 1:2936723-2936745 GGAAATGTACCCATGCAGGAGGG + Intergenic
901327262 1:8374695-8374717 GAAGAAGTAGTCAAGCAGCTGGG - Intronic
903472872 1:23599452-23599474 GGAAATGAACCCAGGCAGCCTGG - Intronic
907265365 1:53256535-53256557 GAAGATGTTGCCAAGCAGCTTGG + Intronic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
909098877 1:71324925-71324947 GAAAATGTATCTAATGAGCTAGG - Intergenic
909917578 1:81338790-81338812 GAAACTGAACCCGGGCAGCTTGG + Intronic
911446236 1:97996163-97996185 AAAAATATAACCAAACAGCTTGG - Intergenic
911488164 1:98528185-98528207 GAACATGAAGCCAAACAGCTTGG + Intergenic
911687792 1:100797126-100797148 TAAAATGTAAACAAGCAACTGGG - Intergenic
912383613 1:109260622-109260644 GTAAATGTGCACAAGCAGATGGG - Intronic
915739003 1:158103911-158103933 GAGAATGTGCCCATCCAGCTGGG + Intergenic
916226774 1:162496936-162496958 GAACATGTACCCAAGGTGGTTGG + Intergenic
917697868 1:177546622-177546644 GAAAATATACCCAAAGTGCTGGG + Intergenic
917995768 1:180437022-180437044 GAACATGTACCCAAGCTGATGGG - Intronic
919078309 1:192839091-192839113 GAATATGTACCCAAGGTGGTCGG + Intergenic
923328719 1:232902874-232902896 GAACATGTACCCAAGGTGGTTGG + Intergenic
923625620 1:235611617-235611639 GACAATGTTGCCAAGCAGGTGGG + Intronic
924583872 1:245345056-245345078 GAAAATTTACCCTTGCTGCTGGG - Intronic
1062966773 10:1613467-1613489 GAAAATCCACCCCAGCAGCAGGG + Intronic
1063731714 10:8705046-8705068 GAAAATGTATGCAAGGTGCTTGG + Intergenic
1063825525 10:9893065-9893087 GAAACTGTGCCCAAGCTACTGGG + Intergenic
1064361220 10:14666616-14666638 GAAAACGTTCCCAACCATCTTGG - Intronic
1065838952 10:29684324-29684346 GAACATGTACCCAAGGCGGTTGG + Intronic
1067416132 10:46104618-46104640 GAAAGTTTATCCAAGCAGATGGG - Intergenic
1067436273 10:46281106-46281128 GAAAGTTTATCCAAGCAGCTTGG - Intergenic
1068218754 10:54016294-54016316 GAAAATGGAACAAAGCAGTTTGG + Intronic
1069022717 10:63506537-63506559 GAAAGTTTACAAAAGCAGCTAGG - Intergenic
1069585681 10:69599931-69599953 GAACATGTACCCAAGGTGGTGGG - Intergenic
1069810119 10:71152960-71152982 GCAAATGGACCAAAGCAGCAAGG + Intergenic
1070340690 10:75495503-75495525 GAAAAAGTGACCAAACAGCTGGG + Intronic
1070491198 10:76978256-76978278 GAAAATGTGCCCCATCAGTTTGG + Intronic
1070640504 10:78165445-78165467 AGAAATGTATCCAAGCACCTAGG - Intergenic
1070735977 10:78863939-78863961 CACACTGTACCCAAGCAGCAGGG + Intergenic
1071032150 10:81197462-81197484 GAACATGTACCCAAGGTGGTTGG - Intergenic
1071074017 10:81730058-81730080 GAAAATGTGCCCAAGGTGGTTGG + Intergenic
1071935806 10:90528910-90528932 GTAAATGGCCCCTAGCAGCTGGG - Intergenic
1073718608 10:106139175-106139197 CAGAATCTACCCCAGCAGCTAGG - Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1076257341 10:129038158-129038180 AATAATGTACACAAGGAGCTTGG + Intergenic
1077815462 11:5682285-5682307 GAAAGAATACCCAAGTAGCTGGG - Intronic
1078000200 11:7488137-7488159 AAAAATGTACCCAAGCAACGAGG + Exonic
1079264764 11:18920745-18920767 GAAAATGTATCCTAGAAACTGGG + Intergenic
1079266939 11:18942892-18942914 GAAAATGTATCCTAGAAACTGGG + Intergenic
1079464947 11:20721009-20721031 GAAAATGTACCTGATGAGCTTGG - Intronic
1080722162 11:34860392-34860414 GAAACTGAATCCAAACAGCTGGG - Intronic
1080873292 11:36255752-36255774 GAACATGTGCCCAAGGAGGTCGG + Intergenic
1080881764 11:36327955-36327977 GAACATGTACCCAGGGAGATTGG - Intronic
1080996419 11:37607913-37607935 GAAAATGTACCCATGCATCATGG + Intergenic
1081906468 11:46673517-46673539 GAACAAGTACCCAGGCAGTTGGG - Intronic
1083053153 11:59794783-59794805 GAAAATATAACCAAATAGCTTGG + Intronic
1083638678 11:64133767-64133789 GGAGATGTACCCGGGCAGCTGGG - Intronic
1085039303 11:73317583-73317605 GGAAATGTGCCCAGGCAGCCTGG + Intronic
1087870253 11:103285235-103285257 GAATTTGTACCCAAGAAGCAGGG + Intronic
1088646020 11:111917166-111917188 TAAAAAGCACCTAAGCAGCTGGG - Intronic
1088993784 11:114978222-114978244 GGAAATGATCCCAAGCAGCTGGG + Intergenic
1091066623 11:132519561-132519583 GAAAATGTACGCAAGCAAAGGGG + Intronic
1093762386 12:22924865-22924887 GAACATGTACCCAAGGTGGTTGG - Intergenic
1094618447 12:32057388-32057410 GAACATGTGCCCAAGGAGGTTGG - Intergenic
1095181410 12:39150645-39150667 TAAAATGTCCCCCAGCAGCAGGG - Intergenic
1095314636 12:40745306-40745328 GAACATGTGCCCAAGGTGCTCGG + Intronic
1095616231 12:44192811-44192833 GAAAATATAACCAGACAGCTTGG - Intronic
1095681747 12:44985218-44985240 CAAAAAGTACCCAACCAGCTGGG - Intergenic
1095875716 12:47078802-47078824 GAAAAGGTTCCCAGGCACCTTGG + Exonic
1098315311 12:69186298-69186320 GAAAATGTGCCCAAGGTGGTTGG - Intergenic
1100180960 12:92085944-92085966 GAAAATATAAACAAGCTGCTTGG + Intronic
1101468321 12:104970732-104970754 GAAAATGTGCACAGGCAGGTGGG - Intergenic
1101551320 12:105764968-105764990 GACAATGTTGCCAAGAAGCTTGG - Intergenic
1101855767 12:108441486-108441508 GAAAGTGTGCCCAAGGAGGTTGG - Intergenic
1102242626 12:111334589-111334611 GAAGATGTACTCAGGCAGCCAGG + Exonic
1103997939 12:124842145-124842167 GTAAATGTGCCCAAACAGCTGGG + Intronic
1104326230 12:127801372-127801394 GAACATGTACCCAAGGAGGTTGG - Intergenic
1104350473 12:128040843-128040865 GAACATGTACCCAAGGTGGTCGG - Intergenic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1106933390 13:34691487-34691509 GAAATTCAACCCAGGCAGCTTGG + Intergenic
1108589707 13:51902238-51902260 GAAAATGTAACAAGGCAACTGGG - Intergenic
1108953913 13:56126206-56126228 GAAAATATCTCAAAGCAGCTGGG - Intergenic
1111548188 13:89771991-89772013 GAAAATGTACCTAAACATTTAGG - Intergenic
1112605942 13:100905734-100905756 GAACATGTACCCAAGGTGGTTGG - Intergenic
1114444331 14:22776670-22776692 AAAAAACTAGCCAAGCAGCTGGG + Intronic
1116091779 14:40317199-40317221 GAAAATGCTGTCAAGCAGCTTGG + Intergenic
1116948021 14:50854267-50854289 GAATTTGAACCCAGGCAGCTTGG - Intergenic
1118847444 14:69558353-69558375 CAAAATGTTGCCAGGCAGCTGGG - Intergenic
1120267665 14:82272198-82272220 GAACATGTTCCCAAGCTGGTTGG + Intergenic
1121684022 14:95818685-95818707 GAGAATGTACACAAGGAGCCAGG + Intergenic
1121707069 14:96004906-96004928 GAAAATGTACCAGAGTATCTGGG + Intergenic
1124237346 15:28002224-28002246 GAAAATATACCTAACCAACTTGG + Intronic
1126847405 15:52773662-52773684 GAATATGTACCAAATGAGCTTGG + Intronic
1127507285 15:59609632-59609654 GAACATGTACCCAAGGTGGTTGG - Intronic
1130324869 15:82871897-82871919 TTAAAGGAACCCAAGCAGCTAGG - Intronic
1130897200 15:88180850-88180872 GAAAATGTCCCAAAGCTGCCGGG + Intronic
1132374717 15:101321350-101321372 GAAGAGGACCCCAAGCAGCTAGG - Intronic
1135965338 16:27030598-27030620 GGAAATGCACCCAAGGAACTGGG + Intergenic
1136046707 16:27620958-27620980 GTAAATGGACTTAAGCAGCTAGG + Intronic
1136958255 16:34811101-34811123 GGCAATGTATCCAAGCAGGTAGG - Intergenic
1137379301 16:47982605-47982627 AAAAATGTACCATGGCAGCTGGG - Intergenic
1138397516 16:56716915-56716937 AAAAATGTACCAAAGGAGCTTGG - Intronic
1138987126 16:62343152-62343174 GAAATTGAACCCAAGCAGGATGG - Intergenic
1140054298 16:71512036-71512058 GAACATGTGCCCAAGCTGATCGG + Intronic
1141648430 16:85379607-85379629 GAAAACGTACCCCAGGAGCTGGG - Intergenic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1157596216 18:48865383-48865405 GAAAATGTTCCCAGGCAATTCGG - Intergenic
1158035612 18:53026011-53026033 GAAAATGTTCCAATTCAGCTTGG + Intronic
1158439309 18:57460036-57460058 CAAAAGCTTCCCAAGCAGCTAGG + Intronic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1160168830 18:76536130-76536152 GAAACAGTACCCTAGCAGCTCGG - Intergenic
1161512150 19:4677784-4677806 GAAAAAGTAACCAGGCAGCTGGG - Intronic
1162482652 19:10937495-10937517 GAACATGTACCCAAGGTGGTTGG + Intergenic
1164225473 19:23241907-23241929 GAAAATGCACCCAAACAGGAAGG + Intronic
925933937 2:8735079-8735101 GAACATGAACACAAGCTGCTGGG + Intronic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
928816374 2:35299595-35299617 GAAAATGCTCACAAGCATCTTGG + Intergenic
929451221 2:42038969-42038991 GTAAATGTACCCAGGTAGGTGGG - Intergenic
929580557 2:43079442-43079464 GAAGAGGAACCCAGGCAGCTAGG - Intergenic
929657586 2:43749429-43749451 GAACATGTACCCAAGGTGGTCGG - Intronic
930458063 2:51631995-51632017 GAAAATGTACTGAAGCATGTTGG + Intergenic
932859410 2:75274375-75274397 GAAAATCTGGCCAGGCAGCTGGG + Intergenic
934155735 2:89198346-89198368 GAACATGTACCCAAGGTGGTTGG - Intergenic
934211586 2:89984413-89984435 GAACATGTACCCAAGGTGGTTGG + Intergenic
935215652 2:100973487-100973509 CAAACTGTAACCAAGCAGCAAGG + Intronic
935806018 2:106748394-106748416 GGCAAAGTACCCAAACAGCTTGG - Intergenic
937268683 2:120633379-120633401 GACTCTGCACCCAAGCAGCTCGG + Intergenic
938470210 2:131553136-131553158 AAAAATGCACCAAAGAAGCTGGG - Intergenic
940073538 2:149716099-149716121 GAACTTGAACCCAAGCAGCCTGG - Intergenic
940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG + Intronic
942890787 2:180984648-180984670 AAAAATGTTCCCAAGCAATTAGG - Intronic
943671555 2:190666911-190666933 GAAAATATTCCCAAGCAGTTGGG - Intronic
946125865 2:217562123-217562145 GAACATGTACCCAAGGTGGTTGG - Intronic
947789916 2:232859501-232859523 GAGACTGTCCCCAAGCAGATTGG + Intronic
947845866 2:233243310-233243332 GAAACTTTTCCCAAGAAGCTTGG + Intronic
1168845747 20:943441-943463 GAAAATGTGCCCAAGGTGGTTGG + Intergenic
1171141039 20:22742854-22742876 GAAAAAGTACTCAAGGAGGTAGG - Intergenic
1171540936 20:25955604-25955626 GAAAATGTTCCCAAGGTGGTTGG + Intergenic
1171800127 20:29604704-29604726 GAAAATGTTCCCAAGGTGGTTGG - Intergenic
1171843966 20:30251974-30251996 GAAAATGTTCCCAAGGTGGTTGG + Intergenic
1172276125 20:33680309-33680331 GAAAAGGTACCTATGGAGCTTGG - Exonic
1175115112 20:56676676-56676698 GAAAAGGGACCCAGGCAGCGTGG + Intergenic
1178422567 21:32453933-32453955 GAAAATGTACTCAAAGGGCTGGG + Intronic
1179915079 21:44471857-44471879 GAACATGTACCCAAGGTGGTCGG - Intergenic
1180135036 21:45856765-45856787 GAACATGTACCCAAGGCGGTCGG + Intronic
1181830591 22:25557398-25557420 TAAAATGAGCCCAACCAGCTGGG + Intergenic
1183410967 22:37655028-37655050 GAAAATGTGACGGAGCAGCTGGG + Intronic
1184226550 22:43132190-43132212 GAACAACCACCCAAGCAGCTTGG + Exonic
949439998 3:4070260-4070282 GAACATGTACCCAAGGTGGTTGG - Intronic
950074188 3:10175592-10175614 GAAAAGGTACAAAATCAGCTGGG + Intronic
950568711 3:13787149-13787171 GTACATGTCCCCAAGCAGCCTGG - Intergenic
953403927 3:42651059-42651081 GAACTTGAACCCAAGCAGCCTGG - Intergenic
953534745 3:43769271-43769293 GAAAAGGTGACCAAACAGCTGGG - Intergenic
955626209 3:60922234-60922256 GCAAATGTGCCCAAGCAAGTCGG - Intronic
955696096 3:61638538-61638560 AAAAATCTTCCCAAGTAGCTGGG + Intronic
956214056 3:66830125-66830147 TAAAATGTTTCCAGGCAGCTTGG + Intergenic
957174452 3:76787926-76787948 GAAACAGTACCTAAGCACCTGGG + Intronic
957687358 3:83518628-83518650 GAAAGTGAATCCAAGCACCTTGG + Intergenic
958606399 3:96364110-96364132 GACACTGTACTGAAGCAGCTGGG - Intergenic
959193748 3:103150103-103150125 TAAAATGTTCCCAAGCATTTTGG - Intergenic
960125641 3:113995523-113995545 AAAACTGTACTCAAGGAGCTGGG + Intronic
961322488 3:126085256-126085278 GAACATGTGCCCAAGGAGGTCGG - Intronic
964051042 3:152394080-152394102 GAAAATCTACCCAACAATCTTGG - Intronic
964450197 3:156805093-156805115 GAAAAAGAAGCCAAGCAGGTGGG - Intergenic
964753382 3:160072978-160073000 GAAAAGATACCCAAGCAGACAGG - Intergenic
964832818 3:160904569-160904591 GAAGATGAACTCAAGCAGGTGGG + Intronic
969078603 4:4600840-4600862 GAAAATGTCAACAAGCTGCTGGG + Intergenic
969105077 4:4801405-4801427 GAAGATGAACCCAAGCAATTTGG + Intergenic
973712189 4:53641165-53641187 GAGAAAGTGGCCAAGCAGCTTGG - Intronic
975537440 4:75466634-75466656 GAAAATGTCCCTCATCAGCTTGG - Intergenic
975585487 4:75943871-75943893 AAAAATGTACCTAAGGAACTAGG + Intronic
980162075 4:129176878-129176900 TAAAATTAACTCAAGCAGCTAGG + Intergenic
982087638 4:151852510-151852532 GAAAATGTGTCCAAACAGCCAGG - Intergenic
982828166 4:160026672-160026694 GAAAATGTTCCCAAGAAGGATGG - Intergenic
982955522 4:161760927-161760949 GAAAATGGAGCTAAGCATCTGGG + Intronic
983743978 4:171171092-171171114 GAAAATGTACCCACAAAGCAGGG - Intergenic
984050198 4:174856206-174856228 GAAAGTGTACCCAAGGTGATTGG - Intronic
984573342 4:181419541-181419563 AGAAATGTACCAAACCAGCTGGG - Intergenic
984604725 4:181771962-181771984 GAAAACCTAGCCAAGCATCTAGG + Intergenic
984650926 4:182269836-182269858 GAAAGTGTACCCAAGGAGGTTGG + Intronic
985080948 4:186263298-186263320 TAAAATGTACAAAATCAGCTTGG + Intergenic
986398680 5:7357143-7357165 GAAGATTTTCTCAAGCAGCTGGG + Intergenic
986609429 5:9551879-9551901 GAAACTGGACCCAAGCTGCAGGG - Intergenic
987378618 5:17262039-17262061 GAAAATTTTACAAAGCAGCTTGG - Intronic
988568032 5:32336107-32336129 GAACATGTACCCAAGGTGGTCGG + Intergenic
988612694 5:32742324-32742346 GAAAGTGTACTTAAGAAGCTGGG + Intronic
988738156 5:34043424-34043446 GAAAACATACACAACCAGCTGGG + Exonic
992550293 5:77852919-77852941 AGAAATGTACCCAATCTGCTAGG + Intronic
995281348 5:110339301-110339323 GAAAATGTGCCCAAGGTGGTTGG + Intronic
995668035 5:114566885-114566907 GAAGAAGTACCCAAGGGGCTGGG + Intergenic
997925739 5:138029945-138029967 GAAAATATACACTAGAAGCTAGG + Intronic
998482811 5:142477035-142477057 GAAAATGAACCCAAGTAGAAGGG - Intergenic
998897974 5:146820589-146820611 GAAAATATCCCCAAACAGCATGG - Intronic
1001223701 5:169925870-169925892 GAAGATGTTCCCTGGCAGCTGGG + Intronic
1002038205 5:176489840-176489862 GAAAAGGTACCGAAGCTGCCAGG - Intronic
1003036050 6:2641056-2641078 GTAAATGTAACCATGCAGATAGG + Intergenic
1003231845 6:4261047-4261069 AAACATGTACCCAAGGAGGTTGG - Intergenic
1006196043 6:32243224-32243246 GAAAATGTATCCAAGCTCCAGGG + Intergenic
1006856428 6:37136973-37136995 GAAAATGGAACCAAGCAACTGGG - Intergenic
1007604948 6:43111026-43111048 GAAAATGGACCCAGTCATCTTGG - Intronic
1007611510 6:43152235-43152257 AGAAATGTACCAAAGCAGCCAGG + Intronic
1009346470 6:62617783-62617805 GAACATGTACCCAAGGTGGTTGG - Intergenic
1009357130 6:62764719-62764741 GAACATGTGCCCAAGGAGGTAGG + Intergenic
1011685046 6:89817201-89817223 GAAAATGTGCCCAAGGTGGTCGG - Intronic
1015602104 6:134920696-134920718 TAATATCTACCCCAGCAGCTTGG + Intronic
1015986696 6:138891724-138891746 GAAAATGTGCCCAAGATGGTTGG - Intronic
1017089861 6:150749776-150749798 GAAAATGCACCCAAAGGGCTGGG + Intronic
1017602913 6:156102937-156102959 GAAAATGGAGTCAAGTAGCTTGG - Intergenic
1018197509 6:161367979-161368001 GAGTATGAACCCAGGCAGCTCGG - Intronic
1018406485 6:163488919-163488941 AAAAATCTACCCAAACAGCAAGG - Intronic
1019106914 6:169675515-169675537 GAACATGTACCCAAGGTGGTTGG + Intronic
1020484952 7:8710305-8710327 TAAAATGTCTCCAGGCAGCTGGG + Intronic
1020574210 7:9904574-9904596 GAAAAAGTACGCAAGCATCTGGG + Intergenic
1021265919 7:18522425-18522447 GAAAATGTGGCCAGACAGCTAGG - Intronic
1022950309 7:35332220-35332242 GAAAATGTACCCTGGCGACTTGG - Intergenic
1024502655 7:50129177-50129199 GAAAATGGAACCAAGTACCTAGG + Intronic
1024686172 7:51748130-51748152 GAAAATATACGTAAGCAGATAGG - Intergenic
1025292370 7:57741857-57741879 GAAAATGTTCCCAAGGTGGTTGG + Intergenic
1025957111 7:66191597-66191619 AAAAATTTTCCCAAGTAGCTGGG + Intergenic
1028788604 7:94826548-94826570 GAACATGTACCCAAGGTGGTTGG - Intergenic
1030263202 7:107588063-107588085 TAAAATGTACCCTACCAGCGAGG - Intronic
1030957678 7:115875258-115875280 GAAAATGTAATCAATCAACTAGG - Intergenic
1031081151 7:117258099-117258121 GAACATGTGCCCAAGGAGTTTGG + Intergenic
1033627784 7:143127893-143127915 GAACATGTGCCCAAGGAGGTGGG - Intergenic
1034920391 7:155075168-155075190 GAAAATGTTCCCACGCACTTAGG - Intronic
1036019594 8:4829578-4829600 GAAAATTTACACAATTAGCTGGG + Intronic
1036052250 8:5212729-5212751 GAACATGTGCCCAAGGAGGTCGG + Intergenic
1038304824 8:26389986-26390008 GAAAATGTACCCAAGCAGCTTGG - Intronic
1039538763 8:38344109-38344131 GAAAATGTGTCCAAACATCTAGG - Intronic
1040418825 8:47220392-47220414 GAAAATGTGCCCAAGGCGGTTGG + Intergenic
1040782060 8:51121332-51121354 GAAAAAGTAGCCCAGCTGCTTGG - Intergenic
1041413356 8:57581017-57581039 GAACATGTACCCAAAGAGATTGG - Intergenic
1044436341 8:92168238-92168260 GAAATTGTACACATGCATCTAGG - Intergenic
1044901266 8:96947649-96947671 GGGATTGTAGCCAAGCAGCTTGG + Intronic
1045707946 8:104948277-104948299 GAATATGTACACAATGAGCTAGG + Intronic
1045792020 8:105995116-105995138 GAACATGTGCCCAAGTGGCTGGG + Intergenic
1047135137 8:122069481-122069503 GAACATGTACCCAAGGTGGTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052978701 9:34431154-34431176 GAAAATCTGGCCAGGCAGCTAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054164132 9:61703855-61703877 GAAAATGTTCCCAAGGTGGTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057095368 9:92303002-92303024 GAAAATGTACCTAATTAGCTGGG + Intronic
1057348778 9:94276998-94277020 GAACATGTACCCAAGGTGATCGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058704729 9:107628823-107628845 GAAAATCTAACCAAACAACTGGG - Intergenic
1059013411 9:110487878-110487900 GAACATGAACCCAACCAGCTTGG + Intronic
1060246799 9:121953335-121953357 GAAAATTAACCAAAGCAGCCAGG + Intronic
1186050818 X:5593047-5593069 GAAACTGTGCCCAACCGGCTTGG + Intergenic
1186074179 X:5859026-5859048 GAATATGTAGCAAAGCAGTTCGG + Intronic
1186428804 X:9486710-9486732 GAACATGTACCCAAGGCGGTTGG - Intronic
1188285990 X:28326168-28326190 GAACATGTACCCAAGGTGTTCGG + Intergenic
1189094912 X:38127894-38127916 GAAAATGTACCCGAGCAGTGGGG - Exonic
1190758039 X:53417956-53417978 GAAAAGGAAACTAAGCAGCTAGG + Intronic
1190842586 X:54159411-54159433 CAAGAAGTAGCCAAGCAGCTGGG - Exonic
1193003959 X:76595557-76595579 GAAAATGTACTTCAGCATCTGGG + Intergenic
1193240996 X:79169208-79169230 AAAAATCTGCCCAAGGAGCTTGG + Intergenic
1194256646 X:91643485-91643507 GAACATGTACCCAAGCTCATTGG - Intergenic
1195566848 X:106348866-106348888 GAAAATGTACCTAAGGAAATGGG - Intergenic
1197479386 X:126963449-126963471 GAATATGTACCCAAGGTGGTTGG - Intergenic
1200231657 X:154446723-154446745 GAAAATGTGCCCAGCCAGCCTGG - Intronic
1200684724 Y:6247963-6247985 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1200990254 Y:9339228-9339250 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1200992915 Y:9359543-9359565 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1200995569 Y:9379821-9379843 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1200998234 Y:9400167-9400189 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1201000744 Y:9468701-9468723 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1201003410 Y:9489031-9489053 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1201006066 Y:9509313-9509335 GAAAGGTGACCCAAGCAGCTGGG - Intergenic
1201008724 Y:9529626-9529648 GAAAGGTGACCCAAGCAGCTGGG - Intronic
1201333977 Y:12859010-12859032 GAGAATGTACCCAAGAGTCTTGG - Intronic