ID: 1038307490

View in Genome Browser
Species Human (GRCh38)
Location 8:26417775-26417797
Sequence CCTTGGGACCCGAAGTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 1, 2: 9, 3: 216, 4: 468}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038307490_1038307495 1 Left 1038307490 8:26417775-26417797 CCAAAGCACTTCGGGTCCCAAGG 0: 1
1: 1
2: 9
3: 216
4: 468
Right 1038307495 8:26417799-26417821 ATATACCCAGCCTGTACTACAGG No data
1038307490_1038307498 6 Left 1038307490 8:26417775-26417797 CCAAAGCACTTCGGGTCCCAAGG 0: 1
1: 1
2: 9
3: 216
4: 468
Right 1038307498 8:26417804-26417826 CCCAGCCTGTACTACAGGGCTGG No data
1038307490_1038307502 27 Left 1038307490 8:26417775-26417797 CCAAAGCACTTCGGGTCCCAAGG 0: 1
1: 1
2: 9
3: 216
4: 468
Right 1038307502 8:26417825-26417847 GGCTGGCATGACATCAAACATGG No data
1038307490_1038307500 10 Left 1038307490 8:26417775-26417797 CCAAAGCACTTCGGGTCCCAAGG 0: 1
1: 1
2: 9
3: 216
4: 468
Right 1038307500 8:26417808-26417830 GCCTGTACTACAGGGCTGGCTGG No data
1038307490_1038307496 2 Left 1038307490 8:26417775-26417797 CCAAAGCACTTCGGGTCCCAAGG 0: 1
1: 1
2: 9
3: 216
4: 468
Right 1038307496 8:26417800-26417822 TATACCCAGCCTGTACTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038307490 Original CRISPR CCTTGGGACCCGAAGTGCTT TGG (reversed) Intronic
900674183 1:3873856-3873878 GCTGGGGACCAGAAGTGTTTTGG - Intronic
901819524 1:11818441-11818463 GCTTGGGACCAGAAGTGTTTTGG - Intronic
902891884 1:19450261-19450283 GCTGGGGACCTGAAGTGTTTTGG + Intronic
903099648 1:21017820-21017842 GCTTGGGACCAGAAGAGTTTTGG - Intronic
903904061 1:26671056-26671078 GCTTGGGACCAGAAATGTTTTGG - Intergenic
904124590 1:28228727-28228749 GCTTGGGACCAGAAGTTTTTTGG - Intronic
904482720 1:30804233-30804255 GCTTGGGACCAGAAGTGTTTGGG + Intergenic
905199989 1:36308647-36308669 GCTTGGGACCAGAAGTGTTTCGG + Intronic
905679728 1:39860531-39860553 GCTTGGGACCAGAAGTGTTTTGG - Intronic
906947064 1:50303734-50303756 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
907063668 1:51457462-51457484 GCTTGGGACCAGAAGTGTTTTGG + Intronic
908033469 1:60027026-60027048 ATTTGGGACCAGAAGTGTTTTGG - Intronic
908274617 1:62457413-62457435 GCTTAGGACCAGAAGTGTTTGGG - Intronic
909001149 1:70219177-70219199 GCTTGGGACCATAAGTGTTTTGG - Intronic
910656771 1:89627995-89628017 CCTTGGGACCAGAAGTGTTCTGG - Intergenic
910921735 1:92355862-92355884 GCTTGGGACCAGAACTGTTTTGG - Intronic
911758162 1:101584600-101584622 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
912693977 1:111826912-111826934 GCTTGGGACCAGAAGTGTTTTGG + Intronic
913253391 1:116931246-116931268 GTTTGGGACCAGAAGTGTTTGGG - Intronic
913961895 1:143345989-143346011 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
914056250 1:144171563-144171585 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
914122896 1:144794799-144794821 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
914349284 1:146826447-146826469 CCTTGGGTCCCAAAGTCCCTGGG - Intergenic
914454140 1:147819844-147819866 GCTTGTGACCAAAAGTGCTTTGG - Intergenic
915192218 1:154161163-154161185 GCTTGGGAGCAGAAGTGTTTTGG - Intronic
915951583 1:160192966-160192988 CCTTGGGATCCGAGGGGCTTGGG + Intronic
916323473 1:163531996-163532018 GCTTAGGACCAGAAGTGTTTTGG + Intergenic
916359143 1:163948511-163948533 GCTTGGAACCAGAAGTGTTTTGG - Intergenic
916867318 1:168874436-168874458 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
917213139 1:172650598-172650620 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
917564691 1:176201216-176201238 GCTTGAGACCAGAAGTGTTTTGG - Intronic
918054540 1:181008321-181008343 GCTTGGGACCAGAAATGTTTGGG + Intronic
918091989 1:181304910-181304932 CCACGGGACCAGAAGTGTTTCGG + Intergenic
918488568 1:185055168-185055190 CCTTAGGACCAGAAGTATTTTGG + Intronic
918603856 1:186397485-186397507 GCTTAGGACCAGAAGTGTTTTGG + Intronic
920840816 1:209552134-209552156 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
922196672 1:223364862-223364884 CCTGGGGACGCGCAGAGCTTCGG - Intergenic
922519414 1:226235475-226235497 GCTTGGGACCAGAAGTGTTTTGG + Intronic
922628505 1:227078968-227078990 GCTTGGGACCGGAAGTATTTTGG - Intronic
922970818 1:229736316-229736338 GCTTGGGACCAGAAATGTTTTGG + Intergenic
923012724 1:230101455-230101477 CCTTGGCACCTGAGGTGCTCAGG - Intronic
923182902 1:231539317-231539339 GCTTGGGACTGGAAGTGTTTTGG + Intronic
923344876 1:233042105-233042127 ACTTGGGACCAGAAGTGTTTTGG - Intronic
923917675 1:238527677-238527699 ACTTGGGACCAGAAGTGCTTTGG + Intergenic
924577413 1:245292896-245292918 CCTTGTGGCCCAAACTGCTTCGG + Intronic
924766472 1:247035824-247035846 ACTTGGGAACGGAAGTGCTTTGG + Intergenic
924829311 1:247575995-247576017 GCTTGGGACCAGAAGTGTTTTGG + Exonic
1063021339 10:2131748-2131770 CCATGGGACCAGATGTGATTTGG + Intergenic
1063567242 10:7181378-7181400 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1064187722 10:13177351-13177373 GCTTGGGACCAGAACTGTTTTGG + Intronic
1064388090 10:14916563-14916585 GCTTGGGAGCAGAAGTGTTTTGG - Intronic
1064427167 10:15239835-15239857 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1064480165 10:15732613-15732635 GCTTGGGACCAGAAGTGTCTTGG + Intergenic
1064569397 10:16676568-16676590 TCTTGGGACCAGAAGTATTTTGG + Intronic
1064801144 10:19073706-19073728 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1065180281 10:23118006-23118028 GCTTAGGACCAGAAGTGTTTCGG - Intronic
1065622385 10:27595848-27595870 GCTTGTGACCAGAAGTGTTTTGG + Intergenic
1065684192 10:28267646-28267668 GCTTGGGACCAGAAGTGTTCTGG - Intronic
1065764891 10:29019516-29019538 TCTTGTGACCAGAAGTGTTTGGG - Intergenic
1066121601 10:32294276-32294298 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1066432094 10:35362147-35362169 GCTTGGTACCAGAAGTGTTTTGG - Intronic
1066482669 10:35812263-35812285 CCTTGGGACCTGATATGGTTTGG + Intergenic
1066676227 10:37890180-37890202 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1067191722 10:44075761-44075783 CCTTAGGACCAGAAGTGTTTTGG - Intergenic
1067819252 10:49512636-49512658 GCTTGGGACAAGAAGTGTTTTGG + Intronic
1067910900 10:50345793-50345815 GCTTGGGACCAGAAGCGTTTCGG - Intronic
1068914684 10:62416677-62416699 GCTTGGGACTAGAAGTGTTTTGG + Intronic
1069324616 10:67218123-67218145 GCTTGGGACCAGAAGTGGTTTGG - Intronic
1070267698 10:74920311-74920333 CCTTGAGACCCCACCTGCTTAGG + Intronic
1070697937 10:78576847-78576869 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1071447861 10:85765725-85765747 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1071590406 10:86867319-86867341 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1072296802 10:94016289-94016311 ACTTGGGACCAGAAGTGTTTTGG + Intronic
1072813364 10:98481110-98481132 CCTCTGGAACCGAAGAGCTTAGG - Intronic
1073069245 10:100782856-100782878 CCTTGGCACCCCAAGTGCTTTGG + Intronic
1073217210 10:101843316-101843338 CCTTGGGTCCCGCAGGGGTTGGG - Intronic
1073504317 10:103970835-103970857 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1074140886 10:110671951-110671973 ACCTGGGACCCGAGGTGCTGAGG + Intronic
1074994945 10:118748723-118748745 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
1075056081 10:119219468-119219490 GCTTGTGACCAGAAGTGCTTTGG - Intronic
1075193246 10:120330626-120330648 GCTTGGGACCAGAGGTGTTTGGG + Intergenic
1076910436 10:133385436-133385458 CAGTGGGACCCTGAGTGCTTTGG + Intronic
1077552865 11:3209297-3209319 CCTTGGGGACCCATGTGCTTTGG + Intergenic
1077665030 11:4100360-4100382 GCTTGGGCCCAGAAGTGTTTCGG + Intronic
1078078902 11:8189191-8189213 GCTTGGGACCAGAGGTGTTTTGG - Intergenic
1078533926 11:12158217-12158239 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1078765384 11:14291838-14291860 GCATGGGACCAGAAGTGTTTGGG + Intronic
1078925676 11:15872693-15872715 CCTTGGGACCAGGAGACCTTAGG + Intergenic
1079069959 11:17336031-17336053 GCTTGGGACCTGAAGTGTTTTGG + Intronic
1080357082 11:31461786-31461808 GCTTGGGACCAGAAGTGTTATGG - Intronic
1080522999 11:33084208-33084230 ACTTGGGACCAGAAGTGTTCAGG - Intronic
1081443161 11:43101929-43101951 GCTTGGGACCAGAAGTGTTTGGG + Intergenic
1082881776 11:58045165-58045187 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1084114552 11:67034460-67034482 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1084938549 11:72600368-72600390 CCTTGGAAGCCCCAGTGCTTGGG - Intronic
1085000148 11:73026227-73026249 CCTTGGGCTCCCAAGTGCTAGGG + Intronic
1085610542 11:77944872-77944894 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1088084606 11:105961550-105961572 TTTTGGGACCAGAAGTGTTTTGG + Intronic
1088344009 11:108802158-108802180 GCATGGGACCAGAAGTGCTTTGG + Intronic
1089072741 11:115713130-115713152 GCTTGGGATCAGAAGTGTTTTGG + Intergenic
1090891592 11:130928285-130928307 GCTTGAGACCAGAAGTGCTTCGG - Intergenic
1091256496 11:134191764-134191786 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1091425615 12:386174-386196 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1091491240 12:934583-934605 CTTTGGGACCAGAAGTGTTTTGG - Intronic
1091763359 12:3102376-3102398 CCTTGGCTCCCAAAGTGCTGGGG + Intronic
1092203052 12:6598901-6598923 GCTTGGGACCAGAAGTATTTTGG + Intronic
1092259444 12:6944877-6944899 GGTTGGGACCGGAAGTGTTTCGG + Intronic
1092770692 12:11893905-11893927 GCTTGGGACCAGAAGTGTTCTGG - Exonic
1092873526 12:12828444-12828466 GCTTGGGACCAGCAGTGTTTCGG - Intronic
1093079809 12:14796715-14796737 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1093185117 12:16011326-16011348 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1093667758 12:21834580-21834602 TCTAGGGAGGCGAAGTGCTTGGG + Intronic
1093919783 12:24846791-24846813 GCTTGGGACCAGATGTGTTTTGG - Intronic
1094173202 12:27516155-27516177 GCTTGGGACCAGAAGTGTTTAGG + Intergenic
1094285557 12:28789309-28789331 TCTTGGGACCAGAATTGTTTTGG - Intergenic
1094475549 12:30837925-30837947 CCTCGGCTCCCGAAGTGCTGAGG - Intergenic
1094694435 12:32803646-32803668 GCTTGAGACCAGAAGTGTTTTGG + Intronic
1096236470 12:49931209-49931231 GCTTGGGACCAGAAATGTTTTGG + Intergenic
1096350787 12:50898881-50898903 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1096662981 12:53140562-53140584 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1097292182 12:57926808-57926830 GCTTGGGACTAGAAGTGTTTTGG + Intergenic
1097921938 12:65085211-65085233 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1098544627 12:71698095-71698117 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1098724545 12:73946323-73946345 GCTTGGGACCAAAAGTGTTTTGG + Intergenic
1098864008 12:75741579-75741601 GCTTGGGAGCAGAAGTGTTTAGG - Intergenic
1098966873 12:76799831-76799853 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1100340470 12:93674726-93674748 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1100687124 12:96998604-96998626 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1100993825 12:100280817-100280839 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1101621129 12:106389571-106389593 GCTTGGGACCAGCAGTGTTTAGG + Intronic
1101669174 12:106850980-106851002 GCTTGGGACCAGAAGTGCTTCGG - Intronic
1102185955 12:110949318-110949340 ACTTTGGACCAGAAGTGTTTGGG + Intergenic
1102343398 12:112141480-112141502 ACTTGGGGCCAGAAGTGGTTTGG + Intronic
1102360209 12:112279779-112279801 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1102378381 12:112442291-112442313 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1102441779 12:112969242-112969264 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1102487199 12:113266497-113266519 CCTTGGGAGCGGAAATGCCTGGG + Intronic
1102800214 12:115725796-115725818 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1102832221 12:116013564-116013586 TCGTGGGACCGGAAGTGTTTGGG - Intronic
1102845747 12:116180542-116180564 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1103121123 12:118380459-118380481 GCTTGGGATCAGAAGTGTTTTGG - Intronic
1105057480 12:133115805-133115827 ACTTGGGACCAGAACTGTTTTGG + Exonic
1105464200 13:20622057-20622079 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1105959861 13:25322728-25322750 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1106150629 13:27097828-27097850 GCTTGGGACCAGCAGTGGTTGGG + Intronic
1106703650 13:32257130-32257152 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1106705374 13:32274020-32274042 GCTTGGGACCAGAAGGGTTTCGG - Intronic
1106728264 13:32509355-32509377 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1108002533 13:45917368-45917390 GCTTGGAACCAGAAGTGTTTTGG + Intergenic
1108085406 13:46784835-46784857 CCTTTGGACCAGGAGTGTTTGGG + Intronic
1110544665 13:76743332-76743354 ACTTGAGACCAGAAGTGTTTTGG - Intergenic
1110588879 13:77230469-77230491 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1110782820 13:79486172-79486194 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1111691631 13:91570440-91570462 CCTTTGGAACACAAGTGCTTTGG - Intronic
1111715191 13:91870889-91870911 GCTTGGTACCAGAAGTGATTAGG + Intronic
1111924070 13:94444273-94444295 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1112565045 13:100545455-100545477 CCTGGGGCCCTGGAGTGCTTGGG - Intronic
1112637376 13:101230204-101230226 GCTTGGGAACAGAAGTGTTTTGG - Intronic
1113359224 13:109613367-109613389 GCTTGGGACCAGAAGTGCTTTGG + Intergenic
1113446197 13:110369448-110369470 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1113519342 13:110928119-110928141 GCTTAAGACCCGAAGTGTTTTGG - Intergenic
1113746421 13:112748185-112748207 GCTTGGGACCAGATGTGCTTTGG - Intronic
1113986065 13:114316729-114316751 GCTTGGAACCAGAAGTGCTTTGG + Intronic
1115187273 14:30703855-30703877 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1115229043 14:31138186-31138208 GCTTGGAACCAGAAGTGTTTTGG - Intronic
1115981925 14:39062237-39062259 GCTTGGGACCCGAAATGTTTTGG + Intronic
1117148805 14:52864081-52864103 TCTTGGGACCAGAAGTATTTTGG + Intronic
1117393623 14:55286778-55286800 GCTTGGGACCAGAAGTGGTTTGG + Intronic
1117423100 14:55566956-55566978 ACTTGGGACCAGAAGTGTTTTGG + Intronic
1117586301 14:57210406-57210428 TCTTGGGACCAGAAGTGTTTTGG + Intronic
1117862289 14:60104981-60105003 CCTTGAGACCAGAAGTGTTTTGG + Intronic
1118392886 14:65310605-65310627 GCTTGGGACCAGAAATGTTTTGG - Intergenic
1118561637 14:67090589-67090611 GCTTGGGACCAGAAGTATTTTGG - Intronic
1118587981 14:67374269-67374291 GCTTGGGACCAAAAGTGTTTTGG - Intronic
1119055020 14:71410500-71410522 GCTTGGGACCGGAAGTGTTTAGG + Intronic
1119065554 14:71522425-71522447 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1119610956 14:76061761-76061783 GCTTAGGACCAGAAGTGTTTCGG + Intronic
1120089249 14:80312057-80312079 GCCTGGGACCAGAAGTGTTTCGG + Intronic
1121058817 14:90884464-90884486 GCTTGGGACCAGAAGTATTTTGG - Intronic
1121592538 14:95127399-95127421 GCTTGGGACCTGAACTGTTTTGG + Intronic
1121671128 14:95711568-95711590 CCTTGGCTCCCGAAGTGGTAAGG + Intronic
1121771323 14:96544435-96544457 GCTTGGGACCAGAAGTGTTTAGG + Intronic
1123001593 14:105298168-105298190 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1124447878 15:29754668-29754690 GCTTGGGACCAGAACTGTTTTGG + Intronic
1125562023 15:40641727-40641749 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1125816024 15:42585171-42585193 GCTTGGGACCAGAACTGTTTCGG - Intronic
1126136124 15:45393666-45393688 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1126171682 15:45700502-45700524 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1127512279 15:59654819-59654841 GCTTGGGACCTGAAGTCTTTTGG + Intronic
1128630020 15:69255437-69255459 GCTTGGGACCAGAAGGGTTTTGG - Intronic
1129544556 15:76381467-76381489 CCTTGGGACTGGCAGTGCTGGGG + Exonic
1129978044 15:79839038-79839060 TCTTGGGACCAGAAGTGTTTTGG - Intronic
1130024257 15:80257690-80257712 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
1130564841 15:84984936-84984958 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1131129141 15:89884014-89884036 GTTTGGGACCAGAAGTGTTTTGG - Intronic
1131204813 15:90434680-90434702 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1131318388 15:91362486-91362508 CCTTGGGACAAGAAGTGTTTTGG - Intergenic
1131381983 15:91971908-91971930 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1131655137 15:94448639-94448661 GCTTGGGACCAGAAGTGTTCTGG - Intronic
1135010763 16:18875627-18875649 ACTTGGGACTGGAAGTGTTTTGG - Intronic
1135501140 16:22996768-22996790 CCTTGGGACACTTAGTGCCTGGG + Intergenic
1135570272 16:23544025-23544047 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1135864411 16:26087659-26087681 GCTTGTGACCAGAAGTGTTTTGG + Intronic
1137764715 16:50968999-50969021 GCTTGGGACCAGAAATGATTTGG + Intergenic
1138523463 16:57587136-57587158 GCTTGGGACCAGCAGTGCTTTGG + Intronic
1139234883 16:65327331-65327353 CCTTGGCTCCCAAAGTGCTGGGG + Intergenic
1139416874 16:66819567-66819589 GCTTGGGACCATAAGTGTTTTGG + Intronic
1139419050 16:66837514-66837536 TCTTGGGACCAGAAATGTTTTGG - Intronic
1139618930 16:68121112-68121134 GCTTGAGGCCAGAAGTGCTTGGG - Intronic
1139831606 16:69802960-69802982 GCTTGGGACTGGAAGTGTTTTGG - Intronic
1139984752 16:70889107-70889129 CCTTGGGTCCCAAAGTCCCTGGG + Intronic
1141085197 16:81089213-81089235 GCTTGGGAGCAGAAGTGTTTTGG + Intronic
1142111509 16:88334337-88334359 GCTCGGGACCAGAAGTGTTTTGG + Intergenic
1142702476 17:1672058-1672080 GCTTGGGACCAGAAATGTTTTGG - Intronic
1143120243 17:4602051-4602073 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1143235390 17:5395294-5395316 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1143583373 17:7839036-7839058 GATTGGGACCCCAAGTGTTTGGG + Intergenic
1144629369 17:16862692-16862714 CCTTGGGTGCCGCAGAGCTTGGG - Intergenic
1144652058 17:17013424-17013446 CCTTGGGTGCCGCAGAGCTTGGG + Intergenic
1145160940 17:20573258-20573280 CCTTGGGTGCCGCAGAGCTTGGG - Intergenic
1145902089 17:28495975-28495997 CCTTGGGCCCCAAGGCGCTTTGG + Intronic
1146234909 17:31150106-31150128 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1146733112 17:35212650-35212672 CCTTGGTAGCTGAAGTGCCTGGG + Intergenic
1148146998 17:45372352-45372374 CCTTGGGGCCAGATGTGCTTTGG - Intergenic
1148263203 17:46202329-46202351 GCTTGGGACCAGAAGTTTTTTGG - Intronic
1148665827 17:49374073-49374095 GCTTGGAACCAGAAGTGCTTTGG - Intronic
1148938850 17:51189257-51189279 CCTTGGGACCAGATGTGCATTGG - Intronic
1149356078 17:55840927-55840949 TCTTGGGACCAGAAGTGTTTAGG - Intronic
1149508963 17:57221395-57221417 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
1149810728 17:59668311-59668333 CTTTGGGAGGCCAAGTGCTTGGG + Intronic
1150422714 17:65053153-65053175 GCCTGGGACCAGAAGTGTTTTGG + Intronic
1150880059 17:69014452-69014474 GTTTGGGACCAGAAGTGTTTCGG - Intronic
1151138962 17:71973698-71973720 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1151359598 17:73580745-73580767 GCTTGGGACCCAAAGCGTTTTGG + Intronic
1151987914 17:77555961-77555983 CCTTGGAAACCAAATTGCTTTGG + Intergenic
1152079451 17:78177487-78177509 GCCTGGGACCAGAAGTGTTTCGG - Intronic
1152441533 17:80312834-80312856 CCTGGGGAATGGAAGTGCTTTGG + Intronic
1152443051 17:80321062-80321084 GCTTGAGACCAGAAGTGTTTTGG + Intronic
1152517697 17:80835806-80835828 GCCTGGGACCGGAAGTGTTTTGG - Intronic
1152742242 17:82023425-82023447 GCTGGGGCCCCGCAGTGCTTGGG - Exonic
1153197493 18:2616741-2616763 GCTTGGGACCAGAATTGTTTTGG + Intergenic
1153214233 18:2803823-2803845 GGTTGGGACCTGAAGTGTTTTGG + Exonic
1154350728 18:13580989-13581011 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1155585804 18:27363087-27363109 TCTTGAGACCAGAAGTGTTTTGG + Intergenic
1156965465 18:43086077-43086099 GCTTGGGACCAGAAATGTTTTGG + Intronic
1157169981 18:45394442-45394464 CTTTGAAACTCGAAGTGCTTTGG + Intronic
1157321026 18:46634674-46634696 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1157879055 18:51302191-51302213 ACTTGGGACCTGAAGTGTTTTGG + Intergenic
1158452847 18:57582387-57582409 GCTTGGGACCAGAGGTGTTTTGG - Intronic
1159439937 18:68465367-68465389 GCTTGGGACCAGGAGTGCTTTGG - Intergenic
1159624338 18:70674634-70674656 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1161907384 19:7166951-7166973 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1162239104 19:9334223-9334245 ACTTGGGACCAGAAGTCATTTGG + Intronic
1162508832 19:11104883-11104905 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1163095810 19:15056168-15056190 CCTTGGGAACAGAAGATCTTGGG - Exonic
1163265640 19:16219275-16219297 GCTTGGGAGCAGAAGTGTTTTGG + Intronic
1164979198 19:32600655-32600677 GCTTGGGACCAGCAGTGTTTTGG - Intronic
1165162328 19:33824185-33824207 GCTCGGGACCAGAAGTGTTTTGG + Intergenic
1165582630 19:36881301-36881323 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1167352730 19:48985778-48985800 CCTTGGGCCCCCCAGAGCTTTGG + Intronic
1202695733 1_KI270712v1_random:124246-124268 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
925020380 2:563473-563495 CCTGGGGGCCCGCAGTGCCTGGG - Intergenic
925026800 2:615233-615255 GCTTGGGACCAGAAGTATTTTGG + Intergenic
925108860 2:1316575-1316597 GCTTGAGACCAGAAGTGTTTGGG + Intronic
925634060 2:5925483-5925505 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
925707049 2:6695871-6695893 GCTTGGGACCGGAAGTGTTTTGG + Intergenic
925813868 2:7728155-7728177 GCTTGGGGCCAGAAGTGTTTTGG - Intergenic
925988710 2:9236158-9236180 CCTTGGCACCTGGACTGCTTTGG + Intronic
927543316 2:23931194-23931216 CCTTGGCCCCCAAAGTGCTGGGG - Intronic
927764186 2:25789770-25789792 GCTTGGAACCAGAAGTGTTTTGG - Intronic
928522905 2:32107692-32107714 GCTTGGGACCAGAACTGCTTAGG - Intronic
928581195 2:32709402-32709424 GCTTGGGACCAGAAATGTTTTGG + Intronic
929218216 2:39437465-39437487 GCTTGGGACCCGAAACGCCTCGG + Intergenic
929986365 2:46736812-46736834 GCTTGGGACCAGAAGTGTTTTGG + Intronic
930590472 2:53320904-53320926 GCCTGGGACTAGAAGTGCTTTGG + Intergenic
930779345 2:55208179-55208201 GCGTGGGACCAGAAGTGTTTTGG + Intronic
931006988 2:57861780-57861802 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
931164991 2:59736996-59737018 CCTTGGGACCCAAGGTGCTAGGG - Intergenic
931613187 2:64126004-64126026 CCTTGGGACCGGAAGTGTTTTGG - Intronic
931994695 2:67828837-67828859 ACTTGGGACCAGAAGTGTTTTGG - Intergenic
932259727 2:70317132-70317154 CCTTGGGAGCAGAAGTGCTGAGG + Intergenic
933904922 2:86882487-86882509 ACTTGGGACCATAAGTGTTTTGG - Intergenic
933969943 2:87462152-87462174 CCCAGGGACCCCAGGTGCTTTGG + Intergenic
934276895 2:91581288-91581310 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
936097571 2:109543827-109543849 GCTAGGGACCAGAAGTGTTTTGG + Exonic
936323838 2:111488344-111488366 CCCAGGGACCCCAGGTGCTTTGG - Intergenic
936367304 2:111869675-111869697 ACTTGGGACCCTAAGTGTTTTGG + Intronic
936699821 2:114997797-114997819 CCTTAGGACCAGAAGTGTTTAGG + Intronic
936708539 2:115103872-115103894 GCTTAGGACCAGAAGTGTTTTGG + Intronic
937271655 2:120656711-120656733 GCTTGGGAACAAAAGTGCTTTGG + Intergenic
937330970 2:121029483-121029505 GCTTGGGACCAGAAGCGTTTTGG + Intergenic
938306239 2:130257199-130257221 CCTTGGGACCAGAAGTATTGTGG + Intergenic
938909614 2:135874773-135874795 GCTTGGGACCAGAAGAGTTTGGG - Intronic
938919113 2:135976811-135976833 GCTTGGGACTGGAAGTGTTTTGG - Intronic
939140452 2:138347720-138347742 GCTAGGGACCAGAAGTGTTTTGG + Intergenic
939499408 2:142963834-142963856 ACTTGGGACCAGAAGTATTTTGG + Intronic
939978463 2:148748541-148748563 GTTTGGGACCAGAAGTGTTTTGG + Intronic
940004899 2:149001511-149001533 CCTTGAGACCTGCAGGGCTTTGG + Intronic
940824250 2:158392566-158392588 GCTTGGGACCAGAAGTGTTCTGG - Intronic
941426525 2:165352834-165352856 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
941929441 2:170925499-170925521 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
942113901 2:172708637-172708659 GCTTGGGATCAGAAGTGTTTTGG + Intergenic
942262945 2:174188908-174188930 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
942441339 2:176040046-176040068 ACTTGGGAACAGAAGTGTTTTGG + Intergenic
942543930 2:177043431-177043453 GCTTGGGGCCAGAAGTGTTTTGG - Intergenic
943491759 2:188562077-188562099 CCTGGGGCCCAGAAGTGCTGAGG - Intronic
944117293 2:196202806-196202828 GCTTGGCACCAGAAGTGCTTTGG + Intronic
944644216 2:201762458-201762480 GCTTGGGACCAGAGGTGTTTTGG + Intronic
944926851 2:204474276-204474298 CCTTAGGACCCGAAATGCTGGGG - Intergenic
945312316 2:208328555-208328577 GCTTGGGACCAGAAGTGTTTTGG + Intronic
945952513 2:216053196-216053218 GCTTGGAACCAGAAGTGCTTTGG + Intronic
946370010 2:219275187-219275209 GCTTGGGAACAGAAGTGTTTAGG + Intronic
946710719 2:222502404-222502426 GTTTGGGACCAGAAGTGTTTTGG + Intronic
947822481 2:233081747-233081769 CCTTGGAACCAGAAGAGCATGGG + Intronic
948052628 2:234990161-234990183 CCCTGGGACGAGAAGTGCTTTGG - Intronic
948382684 2:237561732-237561754 ACTTGGGACCAGAACTGTTTTGG + Intergenic
948416315 2:237807714-237807736 GCTTGGGATCCAATGTGCTTAGG + Intronic
948639743 2:239368088-239368110 GCTTGGGACCAGAAGTGTTCAGG - Intronic
948796527 2:240405556-240405578 ACTTGAGACCTGAAGTGTTTGGG + Intergenic
1169113139 20:3045980-3046002 CCTTGGGACCTGTAGTCCTCGGG - Exonic
1169348337 20:4847738-4847760 GCGTGGGACCAGAAGTGTTTTGG + Intergenic
1170194333 20:13674902-13674924 CCTTGGCCCCCAAAGTGCTGGGG - Intergenic
1170232310 20:14063715-14063737 GCTTGGGACCAGAAATGTTTCGG - Intronic
1170653671 20:18266110-18266132 GCATGGGACCAGAAGTGCTTTGG + Intergenic
1170700329 20:18697464-18697486 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1171394225 20:24820958-24820980 GCTTGGGACCAGGAGTGTTTTGG - Intergenic
1172438112 20:34944614-34944636 GCTTGGGACCAGAAGTCTTTCGG + Intronic
1173504295 20:43574910-43574932 ACTTGGCACCTGAAGTGCTTCGG + Exonic
1173587636 20:44195249-44195271 GCTTGGGACCAGAAGTGTTTCGG - Intergenic
1173699162 20:45052008-45052030 GCCTGGGACCAGAAGTGTTTTGG - Intronic
1174712723 20:52724514-52724536 CCATGGGAAACCAAGTGCTTTGG - Intergenic
1174891914 20:54404410-54404432 GTTTGGGACCAGAAGTGTTTCGG + Intergenic
1175537868 20:59727846-59727868 ACTTGGGACCAGAAGTGTTTCGG - Intronic
1177011663 21:15737801-15737823 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1177762447 21:25417722-25417744 CCTTGGGTCCCGAGGTCCCTAGG - Intergenic
1178463247 21:32822470-32822492 ATTTGGGACCAGAAGTGTTTTGG + Intergenic
1178554328 21:33574701-33574723 GCTTGGGACCAGAAGTGTGTCGG - Intronic
1178611893 21:34089945-34089967 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1178868624 21:36352465-36352487 CTTTGAGACCGGAAGTGTTTTGG + Intronic
1178963690 21:37093494-37093516 GCTTGGGATCAGAAGTGTTTTGG - Intronic
1179144461 21:38755170-38755192 GCTTGGGGCCAGAAGTGTTTTGG + Intergenic
1179320007 21:40281859-40281881 CCTTATAACCCAAAGTGCTTTGG - Intronic
1180041938 21:45284598-45284620 CCTTGGGCATCCAAGTGCTTGGG - Intronic
1180692104 22:17725733-17725755 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1180860642 22:19079316-19079338 GTTTGGGACCAGAAGTGTTTTGG - Intronic
1181087507 22:20448365-20448387 GCTGGGGACCAGAAGTGTTTTGG - Intronic
1181545552 22:23600177-23600199 CCCTGGGACCCTAAGGTCTTGGG - Intergenic
1181625960 22:24122309-24122331 GCTTGGGACCAGAAGAGTTTTGG + Intronic
1181814757 22:25429722-25429744 CCGTGGGACCCTAAGGTCTTGGG + Intergenic
1181867260 22:25868616-25868638 CCTGGGGACCCCAAGTGGTTTGG + Intronic
1181961720 22:26626577-26626599 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1182241804 22:28921936-28921958 GCTTGGGACCAGAAGTGTTTCGG + Intronic
1182473655 22:30564064-30564086 GCTTGGGACCAGAAGTGTTTCGG - Intronic
1182625924 22:31645991-31646013 GCTTGGGACTGGAAGTGTTTTGG - Intronic
1182724727 22:32435489-32435511 GCTTGGGACCAGAAGTGTTCTGG - Intronic
1183322258 22:37172312-37172334 CCTTGGCGCCCGCTGTGCTTGGG + Intronic
950068140 3:10130113-10130135 GCTTGGGACCAGAGGTGTTTTGG - Intergenic
950761407 3:15232053-15232075 ACTTGGGACCAGAAGTGTTTTGG + Intronic
950971771 3:17196318-17196340 CCATGGGACACAAGGTGCTTGGG + Intronic
951050165 3:18085091-18085113 GCTTGGGACCAGAAGTATTTTGG - Intronic
951086967 3:18523537-18523559 GCTTGGGACAAGAAGTGTTTTGG - Intergenic
951230680 3:20175444-20175466 GCTTGGGACCAGAAGTGTTTTGG - Intronic
952306562 3:32152027-32152049 ACTTGTGACCAGAAGTGTTTTGG + Intronic
952813884 3:37430418-37430440 CCTTTGGAGGAGAAGTGCTTTGG + Intronic
952874090 3:37927452-37927474 GCTTGGGACCAGAAGTGTTTTGG - Intronic
952994860 3:38869882-38869904 GCTTGGGACCAGAAGTGTTTCGG - Intronic
953429285 3:42824154-42824176 GCTTGGCACCAGAAGTGTTTTGG - Intronic
953777398 3:45832510-45832532 CCTTGGGACTAGAAGTGTTTTGG - Intronic
954326593 3:49867472-49867494 GATTTGGACCCCAAGTGCTTGGG - Intronic
955993415 3:64653081-64653103 GCTTGGGACCAGAAGTGTTTTGG - Intronic
956013384 3:64855535-64855557 GCTTGGGACCAGAAATGTTTTGG - Intergenic
956947988 3:74245553-74245575 TCTTGGGACCAGAAGTATTTTGG + Intergenic
958679718 3:97312567-97312589 GATTGGGACCAGAAGTGTTTTGG - Intronic
959032447 3:101315646-101315668 GCTTGGGACCAGAAGTGTTGTGG - Intronic
959153704 3:102640024-102640046 ACTTGGGACCAGAAGTGGTTTGG + Intergenic
959319881 3:104858930-104858952 TCTTGGGACCAGAAGTATTTTGG + Intergenic
959589593 3:108063285-108063307 GCCTGGGACCAGAAGTGTTTTGG - Intronic
959856749 3:111167937-111167959 ACTTGGGACTAGAAGTGTTTTGG + Intronic
960813826 3:121653002-121653024 GCTTGGGACCAGAAGTGTTTTGG + Intronic
962248165 3:133815099-133815121 GCTTGGAACCAGAAGTGTTTTGG + Intronic
962566082 3:136661640-136661662 CTTGGGGACCAGAAGTGTTTTGG - Intronic
963687607 3:148456761-148456783 GCTTGGGACAAGAAGTGTTTTGG + Intergenic
963964620 3:151351997-151352019 GCTTGGGACCAGAAGGGTTTTGG + Intronic
964516260 3:157511730-157511752 GCTTGGGACCAGAAATGTTTTGG - Intronic
964572953 3:158130461-158130483 ACTTGGGACCTAAAGTGTTTTGG + Intronic
964969101 3:162538149-162538171 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
965563297 3:170082532-170082554 GCTTGGAACCAGAAGTGTTTTGG - Intronic
965570679 3:170168927-170168949 CCTTGCGACCAGAAGTGTTTCGG + Intronic
966624029 3:181997592-181997614 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
967277018 3:187786102-187786124 GCCTGGGACCAGAAGTGTTTCGG - Intergenic
967344387 3:188437934-188437956 CTTTTGGCCCCCAAGTGCTTCGG - Intronic
967806495 3:193718755-193718777 GCTTGGGACCAGAAGAGTTTTGG - Intergenic
967862527 3:194162647-194162669 GCTTGGGACCAGAAGTGTTGTGG + Intergenic
968055100 3:195685265-195685287 CCTTGGGACCAGAAGTGTTTTGG + Intergenic
968100801 3:195963952-195963974 CGTTGGGACCAGAAGTGTTTTGG - Intergenic
968249898 3:197199546-197199568 ACTTGGGACCAGAAGCGTTTCGG - Intronic
968255348 3:197264811-197264833 ACTTGGGACCAGAAGCGTTTTGG - Intronic
968289759 3:197529479-197529501 GCTTGGGACCAGATGTGTTTTGG - Intronic
969033865 4:4235095-4235117 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
969061314 4:4437533-4437555 GCTTGGGACCAGAAGTGTTTTGG - Intronic
970564943 4:17322874-17322896 GCTTGGGACCAGAAGTATTTTGG + Intergenic
971229522 4:24789553-24789575 GCTTGGGACCAGAATTGTTTCGG + Intergenic
971304560 4:25468283-25468305 GCTTGAGACCAGAAGTGTTTGGG + Intergenic
971360093 4:25930070-25930092 GCTTGGGAACAGAAGTGTTTTGG + Intergenic
971764017 4:30805927-30805949 GCTTGGGACCAGAAGTGTTTTGG + Intronic
972492716 4:39603143-39603165 GCTTGGGACCAGAGGTGTTTTGG - Intronic
972553476 4:40156896-40156918 GCTTAGGACCAGAAGTGTTTTGG - Exonic
972664657 4:41152942-41152964 GCTTGGGACCAGAAGTGTTTTGG + Intronic
972734758 4:41829784-41829806 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
973303170 4:48613019-48613041 GCTTGGGACCAGAAGTGTTTTGG + Intronic
973812009 4:54580469-54580491 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
973865224 4:55106115-55106137 GCTTGGGACCAAAAGTGGTTTGG + Intronic
975028573 4:69584127-69584149 CCTTGGTGCCCAAAGTGCTGGGG - Intergenic
975659234 4:76671799-76671821 GCTTGGAACCAGAAGTGTTTTGG + Intronic
976608422 4:87004569-87004591 GCTTGGGACCAGAATTGTTTTGG + Intronic
976610767 4:87028099-87028121 GCTTGGGACCTTAAGTGTTTTGG - Intronic
976710625 4:88067289-88067311 ACTTGGGATCAGAAGTGTTTTGG - Intronic
977065894 4:92314802-92314824 GCTTGGGACTTGAAGTGTTTTGG - Intronic
977281241 4:95042575-95042597 GCTTGGGGCCAGAACTGCTTTGG - Intronic
977506942 4:97914657-97914679 TCTTGAGACCAGAAGTGTTTTGG + Intronic
977690601 4:99904607-99904629 GCTTGGGACCAGCAGTGTTTTGG - Intronic
977701249 4:100025411-100025433 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
978182275 4:105813588-105813610 GCTTGGGACCAGAAGTATTTTGG - Intronic
978222072 4:106289030-106289052 GTTTGGGACCAGAAGTGTTTCGG - Intronic
978352379 4:107833656-107833678 GCTTGGGACCAGAAGTCTTTTGG - Intronic
978698518 4:111614180-111614202 GCTTGGGACCAAAAGTGTTTTGG - Intergenic
979025932 4:115575391-115575413 TTTTGGGACCAAAAGTGCTTCGG - Intergenic
980941230 4:139276864-139276886 GCTTGGGACCAGAAGTGTTTTGG + Intronic
981374243 4:143995487-143995509 CATTGGGACCCCAGGTCCTTTGG + Intergenic
981383332 4:144098755-144098777 CATTGGGACCCCAGGTCCTTTGG + Intergenic
981408973 4:144405510-144405532 CCTTGGAACCCAAAGAGCTAAGG + Intergenic
981775699 4:148364785-148364807 GCTCGGGACCAGAAGTGTTTTGG + Intronic
982470020 4:155776945-155776967 TCTTGAGACCAGAAGTGTTTAGG + Intronic
983088553 4:163476832-163476854 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
983164762 4:164461378-164461400 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
983563733 4:169127880-169127902 GCTTGTGACCAGAAGTGTTTCGG + Intronic
983595273 4:169459062-169459084 GCTTGGGATCAGAAGTGTTTTGG - Intronic
983595613 4:169463691-169463713 GCTTGGGGCCAGAAGTGTTTTGG + Intronic
983875581 4:172871135-172871157 GCTTGGGACCAGAAGTAATTAGG - Intronic
984687222 4:182683505-182683527 ACTTGGAACCAGAAGTGATTTGG - Intronic
984896481 4:184546070-184546092 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
984967945 4:185157192-185157214 CTTTGGGATCCCAAGTACTTTGG + Intergenic
985125273 4:186687685-186687707 ACTTGGGACTAGAAGTGTTTTGG - Intronic
985502274 5:255904-255926 CCTTGGGACCAGAAGCGTTGTGG + Intronic
985734761 5:1572832-1572854 CCTTGGGACCAGAAGCATTTTGG - Intergenic
986211871 5:5681692-5681714 GCTTGGGACCAAAAGTGTTTAGG - Intergenic
986428396 5:7657166-7657188 GCTTGGGACCAGAAGTGTTTCGG - Intronic
987161191 5:15144849-15144871 GCTTGGGACCAGAAGTATTTTGG + Intergenic
987324191 5:16797334-16797356 GCTTGGGACCTGAAGTGTTTTGG - Intronic
987449770 5:18068096-18068118 GCTTGGGACCAGAAGTGTTTGGG - Intergenic
988569903 5:32353950-32353972 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
989174696 5:38512243-38512265 CCTTGGGACCACAAGTGTGTTGG + Intronic
990588399 5:57235677-57235699 GCTTGGGACCAGAAGTGTTTTGG + Intronic
992060502 5:73040196-73040218 GCTTGAGACCAGAAGTGTTTTGG + Intronic
992272799 5:75083009-75083031 GCTTGGGACCAGAAGTATTTTGG + Intronic
992656525 5:78915649-78915671 ACTTAGGACCAGAAGTGTTTGGG + Intronic
993395934 5:87388547-87388569 GCTTGAGACCAGAAGTGTTTCGG - Intronic
994367958 5:98937266-98937288 GGTTGGGACCAGAAGTGTTTAGG + Intergenic
994469159 5:100180434-100180456 GCTTGGGACTGGAAGTGTTTTGG - Intergenic
994702413 5:103152047-103152069 GCATGGGACCAGAAGTGTTTTGG + Intronic
994934217 5:106232767-106232789 GCTTGGGACCAGAAGTGTTTAGG + Intergenic
995003990 5:107168927-107168949 TCTTGTGACCCGAGTTGCTTTGG + Intergenic
995729797 5:115226350-115226372 ACTTGGGTCCAGAAGTGTTTTGG - Intronic
995762415 5:115577377-115577399 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
995810337 5:116099899-116099921 GCTTGGGACCAGAAGTGTTTTGG + Intronic
996390209 5:122952191-122952213 GCTTGGGACCACAAGTGTTTTGG - Intronic
996412529 5:123174062-123174084 TCTTGGGACCAGAAGAGTTTTGG + Intronic
996693844 5:126370886-126370908 CCTTGGGACCTGAAGAGTTCTGG - Intronic
996703850 5:126477017-126477039 GCTTGGGACCAGAAGTGTTTTGG + Intronic
996739036 5:126782259-126782281 CCTGGGGGCCAGATGTGCTTTGG + Intronic
997575427 5:134972286-134972308 GCTTGGGAACAGAAGTGTTTTGG - Intronic
997912026 5:137884734-137884756 GCTTGGGACCAGAAGTGTTTTGG - Intronic
998243323 5:140470987-140471009 GCTTGGGACCAGAAGTGTTTTGG + Intronic
998916269 5:147014999-147015021 CCTTGGAACAAGAAGTGTTTGGG - Intronic
999009096 5:148015411-148015433 GCTTGGGACGGGAAGTGTTTTGG - Intergenic
999256771 5:150213877-150213899 CCTTGGACCCCAGAGTGCTTTGG + Intronic
999402974 5:151281317-151281339 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1000217666 5:159178777-159178799 GCTTGGCACCAGAAGTGTTTTGG - Intronic
1000638013 5:163665714-163665736 GCTTGGGACCAGAAGTATTTTGG + Intergenic
1001197714 5:169688463-169688485 GCTTGGGACCAGAATTGTTTTGG + Intronic
1001480320 5:172084731-172084753 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1001584251 5:172822211-172822233 GCCTGGGACCAGAAGTGTTTTGG + Intergenic
1001606992 5:172968123-172968145 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1002628052 5:180546836-180546858 CCTTGGGATCAAAAGTGATTTGG + Intronic
1003117731 6:3294489-3294511 GCTCGGGACCAGAAGTGTTTTGG - Intronic
1003209078 6:4043381-4043403 CCTTGGGGCCATATGTGCTTTGG + Intronic
1003223552 6:4184152-4184174 GCTTGGGATCAGAAGTGTTTGGG - Intergenic
1003562474 6:7193562-7193584 GCTTGGGACCAGAAGTGTTTGGG + Intronic
1003587421 6:7405422-7405444 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1004052583 6:12100926-12100948 GCTTGGGACCAGAAATGTTTTGG - Intronic
1004364951 6:15004290-15004312 GCTTGGGACCAGAAGTATTTCGG + Intergenic
1004689613 6:17982019-17982041 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1004711246 6:18172591-18172613 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1004737279 6:18420128-18420150 GCTTGGGACCAGTAGTGTTTCGG + Intronic
1004758940 6:18644492-18644514 GCTTGGGACCCGAGGTGTTTGGG + Intergenic
1004792386 6:19041291-19041313 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1005384522 6:25272736-25272758 CCTTGGCCCCTAAAGTGCTTGGG - Intergenic
1006661954 6:35654316-35654338 GCTTGGGACAAGAAGTGTTTTGG - Intronic
1007019093 6:38501383-38501405 GCTTGGGACCAGAAGTGTTAAGG - Intronic
1007544614 6:42683868-42683890 GCTTGGGACCAGAAGTGCTTTGG - Intronic
1007881152 6:45168290-45168312 GCTTGGGATCGGAAGTGTTTAGG + Intronic
1007888929 6:45267139-45267161 ACTTGGGACCAGAAGTATTTTGG - Intronic
1007904011 6:45440623-45440645 GCTTGGGACCAGAAGTGTTTCGG + Intronic
1007989185 6:46237663-46237685 GCTTGGGGCCAGAAGTGTTTTGG - Intronic
1009890173 6:69671493-69671515 GCTTGGGAACAGAAGTGTTTTGG - Intergenic
1010143907 6:72643667-72643689 GCTTGTGACCAGAAGTGTTTTGG - Intronic
1010242992 6:73634325-73634347 GCTTGGAACCAGAAGTGTTTTGG + Intronic
1010761388 6:79727272-79727294 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1011460393 6:87597064-87597086 TCTTGGGACCAGAAGTGTTTTGG + Intronic
1011576020 6:88800204-88800226 GCTTAGGACCAGAAGTGGTTTGG + Intronic
1011586936 6:88936190-88936212 CCTTTGACCCCAAAGTGCTTTGG - Intronic
1011672148 6:89693706-89693728 TCCTGGGACCAGAAGTGTTTTGG - Intronic
1011987698 6:93470787-93470809 GCTTGGGACCAGAAGGGTTTTGG + Intergenic
1012272290 6:97228671-97228693 GCTTGGGACTAGAAGTGTTTTGG - Intronic
1012442271 6:99271641-99271663 GCTTGGGACCAGAAGTGTTTTGG - Exonic
1012837712 6:104291394-104291416 GCTTGGGACCAGAGGTGTTTTGG + Intergenic
1013165205 6:107583817-107583839 GCTTGGGACCAGAAGTGTTTGGG + Intronic
1014441312 6:121477101-121477123 ACTTTGGACCAGAAGTGTTTGGG - Intergenic
1015113567 6:129620091-129620113 GCTTGAGACCAGAAGTGCTCTGG + Intronic
1015608382 6:134985744-134985766 GCTTGGGACCCAAAGTGTTTGGG - Intronic
1015643044 6:135357440-135357462 GCTTAGGACCAGAAGTGTTTTGG - Intronic
1015762134 6:136674919-136674941 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1016602192 6:145875121-145875143 TCTTGGGACCAGAAGTGTTTTGG - Intronic
1016937740 6:149460313-149460335 ACTTGGGAGCAGAAGTGTTTTGG - Intronic
1016975233 6:149801106-149801128 ATTTGGGACCAGAAGTGTTTTGG + Intronic
1017084144 6:150698045-150698067 GCTTGGGACCACAAGTGTTTTGG + Intronic
1017506767 6:155075581-155075603 GCATGGGACCAGAAGTGTTTTGG + Intronic
1018160451 6:161036920-161036942 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1018331395 6:162731663-162731685 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1018448924 6:163887275-163887297 GCTTAGGACCAGAAGTGTTTGGG - Intergenic
1018642031 6:165913225-165913247 GCTTGGGACCAGAAGTGTCTAGG - Intronic
1018778571 6:167042595-167042617 CCTTGAGACAGGAAGGGCTTTGG - Exonic
1019208922 6:170388694-170388716 ACTTAGGACCAGAAGTGTTTTGG + Intronic
1019449123 7:1087342-1087364 GCTTGGGACCGGAAGAGTTTCGG + Intronic
1019526494 7:1482758-1482780 CCTTGGCACCAGCGGTGCTTGGG - Intronic
1020666000 7:11044824-11044846 GCTGGGGACCAGAAGTGATTTGG + Intronic
1021971582 7:25970449-25970471 GCTTGGGGCCAGAAGTGTTTCGG - Intergenic
1022150056 7:27593307-27593329 GCTTGGGACCTGAAGCGTTTTGG - Intronic
1022150339 7:27596702-27596724 GCTTGGGACCAAAAGTGTTTTGG + Intronic
1022165023 7:27750420-27750442 GCTTGAGACCAGAAGTGCTTTGG - Intronic
1022862968 7:34387096-34387118 CCTTGGGGCCAGACTTGCTTTGG + Intergenic
1022917892 7:34978712-34978734 TCCTGGGACCAGAAGTGTTTTGG + Intronic
1023028871 7:36075953-36075975 ACTTGGGACCAGAAGTGTTTTGG + Intergenic
1023061091 7:36327824-36327846 GCTTGGGACTAGAAGTGTTTTGG - Intronic
1024320074 7:48056694-48056716 CCTTGGGACCAGAAGTGTTTGGG - Intronic
1024492290 7:49999096-49999118 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1025218440 7:57081521-57081543 GCTTGGGACCAGAAGCGTTTTGG + Intergenic
1025257040 7:57391088-57391110 GCTTAGGACCAGAAGTGTTTTGG + Intergenic
1025629359 7:63255140-63255162 GCTTGGGACCAGAAGCGTTTTGG + Intergenic
1025652908 7:63488940-63488962 GCTTGGGACCAGAAGCGTTTTGG - Intergenic
1025842559 7:65164165-65164187 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
1025880486 7:65531803-65531825 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1025892951 7:65670801-65670823 GCTTGAGACCAGAAGTGTTTTGG + Intergenic
1026131432 7:67624155-67624177 GCTTGGGTCCAGAAGTGTTTTGG + Intergenic
1026270930 7:68836241-68836263 TCATGGGACCAGAAGTGTTTTGG - Intergenic
1026427002 7:70304686-70304708 ACTTGAGACCAGAAGTGTTTTGG + Intronic
1027912354 7:84267232-84267254 GCTTGGGACTAGAAGTGTTTTGG - Intronic
1028163115 7:87508419-87508441 ACTTGGGACCAGAAGTGTTTTGG - Intronic
1028229877 7:88294418-88294440 GCTTGGGACCAGAAATGTTTTGG - Intronic
1028282430 7:88947781-88947803 GCTTGGGACCAGAATTGTTTGGG - Intronic
1028741715 7:94283008-94283030 GCTTGGGACCAGGAGTGTTTGGG - Intergenic
1028758981 7:94473515-94473537 CCATGGGACCTGATGTCCTTTGG + Intergenic
1029121169 7:98269349-98269371 CCTTGGCTCCCAAAGTGCTGGGG + Intronic
1029590330 7:101502921-101502943 CCTTGGGACCCAAAGTCACTGGG - Intronic
1029912379 7:104167295-104167317 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1030011079 7:105168444-105168466 CTTTGAGACCAGAAGTGTTTTGG - Intronic
1030075238 7:105731286-105731308 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1030721745 7:112879589-112879611 GCTTAGGACCAGAAGTGTTTTGG + Intronic
1031047522 7:116908969-116908991 GCTTGGGACCAGAAGTCTTTTGG + Intronic
1031858052 7:126945690-126945712 GCCTGGGACCAGAAGTGCTTTGG - Intronic
1031936160 7:127737658-127737680 GGTTGGGACCAGAAGTGATTCGG + Intronic
1031937494 7:127750575-127750597 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1032104288 7:129012617-129012639 GCTTGGGACCAGAAGGGTTTAGG - Intronic
1032638217 7:133734796-133734818 GCTTGGGATCAGAAGTGTTTTGG - Intronic
1032809616 7:135398589-135398611 TCTTGGGAACAGAAGTGTTTTGG - Intronic
1033734315 7:144207065-144207087 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1033748736 7:144343904-144343926 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1034323689 7:150209626-150209648 CCTTGGCCTCCGAAGTGCTGGGG - Intergenic
1034465299 7:151224556-151224578 GCTTGGAACCAGAAGTGTTTCGG - Intronic
1034769509 7:153759581-153759603 CCTTGGCCTCCGAAGTGCTGGGG + Intergenic
1035207971 7:157307138-157307160 TCTTGGGACCCAATGTGCTTTGG + Intergenic
1035359077 7:158298367-158298389 GTTTGGGACTAGAAGTGCTTTGG + Intronic
1035744848 8:1954485-1954507 TCTTGGGACCACAAGTGTTTTGG - Intronic
1035886369 8:3295656-3295678 CCTTGGGATTCTAACTGCTTTGG + Intronic
1036705321 8:11042206-11042228 GCTTGGGACCAGAAGTGTTTAGG + Intronic
1037401387 8:18498422-18498444 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1038118076 8:24580339-24580361 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1038179581 8:25213900-25213922 ACTTGAGACCAGAAGTGTTTTGG + Intronic
1038307490 8:26417775-26417797 CCTTGGGACCCGAAGTGCTTTGG - Intronic
1038508713 8:28109542-28109564 GCCTGGGACCAGAAGTGTTTCGG + Intronic
1038519008 8:28213331-28213353 GCTTGGGACCAGAAGTTTTTTGG + Intergenic
1038886530 8:31668896-31668918 TCTTAGGACCAGAAGTGTTTTGG + Intronic
1039117541 8:34108974-34108996 GCTTGGGACCAGAAGCGTTTTGG - Intergenic
1039915377 8:41856784-41856806 GCTTGGGACCAGAAATGTTTTGG - Intronic
1039928886 8:41964655-41964677 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1040486635 8:47878947-47878969 GCTTGGAACCAGAAGTGTTTCGG - Intronic
1040765586 8:50906181-50906203 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1041307391 8:56476319-56476341 GCTAGGGACCAGAAGTGTTTTGG + Intergenic
1041601725 8:59725826-59725848 ACTTGAGACCAGAAGTGTTTTGG - Intergenic
1041645948 8:60252853-60252875 GCTTGGGACCAGAAGTATTTTGG - Intronic
1042255696 8:66801117-66801139 ACTTGGAACCAGAAGTGATTTGG + Intronic
1042260711 8:66856422-66856444 GTTTGGGACCAGAAGTGTTTTGG + Intronic
1042300642 8:67276755-67276777 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1042559481 8:70062350-70062372 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1042559680 8:70063990-70064012 GCCTGGGACCAGAAGTGTTTTGG - Intronic
1042675328 8:71314491-71314513 GCTTGGGACCAGAAATGTTTTGG + Intronic
1042741071 8:72047816-72047838 TCTTGGGACCAGAAATGATTTGG - Intronic
1042908400 8:73798449-73798471 GGTTGGGACCAGAAGTGTTTTGG - Intronic
1042954935 8:74239679-74239701 ACTTGGGACCCTAAGTGTTTGGG + Intronic
1044100912 8:88137319-88137341 TATTGGGACCAGAAGTGTTTGGG - Intronic
1045105362 8:98887408-98887430 GCTTAGGACCAGAAGTGTTTTGG - Intronic
1045434626 8:102149635-102149657 CCTTGTTACCCGAAGTGTTTCGG - Intergenic
1045580582 8:103475375-103475397 GCTTGGGACCAGAAATGTTTTGG - Intergenic
1045668564 8:104519434-104519456 GCTTGGGACCAAAAGTGTTTTGG + Intronic
1046563382 8:115867635-115867657 CACTGTGACCTGAAGTGCTTTGG - Intergenic
1046591073 8:116208191-116208213 CTTTGGGACCAAAAGTGTTTTGG - Intergenic
1046972867 8:120242191-120242213 GCTTGAGACCAGAAGTGTTTTGG - Intronic
1047476885 8:125241009-125241031 ACCTGGGACCAGAAGTGTTTTGG + Intronic
1047488551 8:125355102-125355124 GCTTGGGACCAGAAGTGTTTCGG - Intronic
1047536369 8:125723753-125723775 GCTTGGGACCAGAAGTGTTTTGG + Intergenic
1048906966 8:139097761-139097783 CCCTGGGCCCCAAAGTGCTCTGG + Intergenic
1049556407 8:143284503-143284525 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1049646425 8:143737896-143737918 CCCTGGGCCCCGAACTGCTGAGG - Intergenic
1050216570 9:3332194-3332216 GCTTGGGACCACAAGTGTTTTGG + Intronic
1050377389 9:4986663-4986685 GCTTGGGACCAAAAGTGTTTTGG + Intronic
1050381776 9:5038566-5038588 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1051689758 9:19698429-19698451 GCTTGGAACCAGAAGTGTTTTGG - Intronic
1051783313 9:20714108-20714130 GCTCGGGACCAGAAGTGTTTTGG + Intronic
1051806042 9:20993437-20993459 GCTTGGGACCAGAGGTGTTTTGG + Intronic
1051835247 9:21330123-21330145 GCTTGGGACCAGAAGTGTTTTGG + Exonic
1053232134 9:36419215-36419237 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1054892889 9:70270989-70271011 ACTTGGGACCAGAAGTGTTTTGG + Intronic
1054894258 9:70290093-70290115 GCTTGGCACCAGAAGTGTTTTGG - Intronic
1055311328 9:74984734-74984756 GCTTGGGACCAGAAATGTTTGGG - Intronic
1055767159 9:79675822-79675844 GCTTGGGACTAGAAGTGTTTTGG + Intronic
1055816439 9:80212634-80212656 TCTTGGGTCCCCAAGAGCTTGGG - Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1056143090 9:83703548-83703570 GCTTGGGACCAGAAGTGTTTGGG - Intronic
1057312055 9:93948922-93948944 CCTGGGGACGCGAAGGGCTGGGG - Intergenic
1057597502 9:96427535-96427557 GCTTGGGACCAGAAGTGTTTGGG + Intergenic
1057976904 9:99614929-99614951 GCTTGGGACAAGAAGTGTTTTGG - Intergenic
1058014213 9:100011878-100011900 GCTTGGGATCAGAAGTGTTTTGG + Intronic
1058363167 9:104174872-104174894 GCTTGGGAGCAGAAGTGTTTTGG - Intergenic
1058473103 9:105301181-105301203 CCATGCCACCCGAGGTGCTTTGG + Intronic
1058694893 9:107550907-107550929 GCTTGAGACCAGAAGTGTTTTGG - Intergenic
1060371071 9:123072068-123072090 GCTTGGGACCGGAAGTGTTGTGG + Intronic
1061174827 9:128988556-128988578 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1061976280 9:134069450-134069472 CCTGGGGACCCCAGGGGCTTGGG - Intergenic
1062679116 9:137767438-137767460 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1186144081 X:6607527-6607549 ACTTGGGACAAGAAGTGTTTTGG - Intergenic
1186484928 X:9926896-9926918 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1186681794 X:11882738-11882760 GCTTGGGACAAGAAGTGTTTCGG - Intergenic
1187183887 X:16966373-16966395 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1187457436 X:19454780-19454802 GCTCGGGACCAGAAGTGCTTTGG + Intronic
1187483599 X:19681004-19681026 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1187488595 X:19728149-19728171 GCTTGGGACCAGAAGTGTCTTGG + Intronic
1187699338 X:21949965-21949987 GCTTGGGACCGAAAGTGTTTTGG - Intronic
1187860446 X:23677497-23677519 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1188001378 X:24985764-24985786 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1188059221 X:25580162-25580184 GCTTGGGACAAGAAGTGTTTTGG - Intergenic
1188280507 X:28262477-28262499 CTTGGGGACCAAAAGTGCTTTGG - Intergenic
1188362844 X:29277716-29277738 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1188550778 X:31362544-31362566 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1188658418 X:32729270-32729292 GCTTGGGACCAGAAGTGTTTTGG - Intronic
1188812611 X:34670078-34670100 GCTTAGGACCAGAAGTGTTTGGG + Intergenic
1188874147 X:35409477-35409499 GCTTGGGACCTGAAGTGTTTCGG - Intergenic
1189299044 X:39939089-39939111 TCCTGGGACCAGAAGTGTTTTGG - Intergenic
1189525619 X:41817544-41817566 CCTTGGGACCAGAAGTGTTTTGG + Intronic
1189827698 X:44936616-44936638 GCTTGGGACCAGAAGTGTTTCGG + Intronic
1189832855 X:44992472-44992494 CCTTGGCCCCCAAAGTGCTGAGG + Intronic
1189976803 X:46469035-46469057 GCTTGGAACCAGAAGTGTTTTGG - Intronic
1190022666 X:46893429-46893451 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1190085406 X:47391361-47391383 ACTTGGCACCAGAAGTGTTTTGG + Intronic
1190784325 X:53629455-53629477 ACTTGGGACCAGAAGTATTTTGG - Intronic
1190794454 X:53727923-53727945 CCTTGGGGCCAGAAGTGTTTTGG + Intergenic
1191652347 X:63553262-63553284 GCTTGGGACAAGAAGTGTTTGGG - Intergenic
1192469453 X:71384817-71384839 GCTTGTGACCAGAAGTGTTTCGG - Intronic
1192575272 X:72238747-72238769 CCTGGGGACCCGAACTGTTGAGG - Intronic
1192599882 X:72451038-72451060 ACTTGGGACCAGAAATGTTTTGG - Intronic
1193132637 X:77933506-77933528 GCTTAGGACCGGAAGTGTTTCGG + Intronic
1193380538 X:80811311-80811333 GCTTGGGACCAGAAATGTTTTGG + Intergenic
1193808360 X:86020723-86020745 GCTTGGGACCAGAAGTGTTTCGG - Intronic
1193808371 X:86021197-86021219 GCTTGGGACCCGAAGTGCTTCGG - Intronic
1194449462 X:94026888-94026910 ACCTGGGACCAGAAGTGTTTTGG + Intergenic
1194546864 X:95246558-95246580 GCTTGGGACCGGAAGTATTTTGG - Intergenic
1195623465 X:106982975-106982997 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1196090664 X:111738294-111738316 GCTTGGGACCAGAAGTGTTTTGG + Intronic
1196106108 X:111897189-111897211 GCTTGGTACCAGAAGTGTTTTGG - Intronic
1196274809 X:113754688-113754710 TTTTGGGACCAGAAGTGTTTTGG + Intergenic
1196904952 X:120422104-120422126 GCTTGGGACCAGAAGTGTTTTGG - Intergenic
1197345171 X:125320978-125321000 CCGTGGGACCAGAAGTGCCATGG + Intergenic
1198089650 X:133315086-133315108 GCTTGGGACAAGAAGTGTTTGGG + Intronic
1198251883 X:134887045-134887067 GCTTGAGACCAGAAGTGTTTAGG - Intergenic
1199885152 X:152013228-152013250 GCTTGGGACTAGAAGTGTTTTGG + Intergenic
1200324121 X:155220002-155220024 GCTTGGGACCAGAATTGTTTTGG - Intronic