ID: 1038312535

View in Genome Browser
Species Human (GRCh38)
Location 8:26455532-26455554
Sequence CCCCCCAATTATCACCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038312535_1038312541 15 Left 1038312535 8:26455532-26455554 CCCAGGGGGTGATAATTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1038312541 8:26455570-26455592 CCATCCTCTGATCACATGGTTGG No data
1038312535_1038312543 24 Left 1038312535 8:26455532-26455554 CCCAGGGGGTGATAATTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1038312543 8:26455579-26455601 GATCACATGGTTGGTTCCTCTGG No data
1038312535_1038312538 11 Left 1038312535 8:26455532-26455554 CCCAGGGGGTGATAATTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1038312538 8:26455566-26455588 GTTCCCATCCTCTGATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038312535 Original CRISPR CCCCCCAATTATCACCCCCT GGG (reversed) Intronic
900460687 1:2800990-2801012 CCCCCCAGTTTTCACCCAGTGGG - Intronic
905090917 1:35430832-35430854 CTCCCCAAGTAGCACTCCCTGGG + Intergenic
906745017 1:48215433-48215455 CCCCCCAATTCTTCCCACCTGGG - Intergenic
907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG + Intronic
908586803 1:65578502-65578524 CCCACCACTCCTCACCCCCTGGG - Intronic
908791104 1:67782443-67782465 CCACCCCATTATCTCCACCTTGG + Intronic
909268614 1:73594265-73594287 TCTCCCAATTATGACCTCCTTGG - Intergenic
909335769 1:74471639-74471661 CACCCAAAATATCAACCCCTTGG - Exonic
912245835 1:107960795-107960817 CCACCTAATTGTCACTCCCTTGG + Intronic
918645161 1:186895550-186895572 TCCCTCAATTATCTCCCTCTGGG + Intronic
920127607 1:203705973-203705995 CCCCCGAATCATCAGGCCCTTGG + Intronic
921947424 1:220895627-220895649 CAGCGCAATTATCACGCCCTGGG - Intergenic
923094570 1:230764411-230764433 CCCCCCAATTCTCAGGCCTTTGG + Intronic
923163641 1:231338699-231338721 CCCCTCATTTAACGCCCCCTGGG - Intronic
1063447607 10:6129271-6129293 CACCCCAAATCTCACCCCCTGGG - Intergenic
1069497220 10:68916276-68916298 CACCGCAACTATCACCTCCTGGG - Intronic
1074962954 10:118464293-118464315 CCCCCCAACTATCCCATCCTCGG + Intergenic
1075124339 10:119687612-119687634 CCCTCAAATCCTCACCCCCTTGG - Intergenic
1076706775 10:132306838-132306860 CCCCCGAATTATCACCTGCAGGG - Intronic
1080145972 11:28984289-28984311 CCCGCCAATTAGAACTCCCTGGG - Intergenic
1083911433 11:65712374-65712396 GCCCTCGATTATCTCCCCCTGGG - Exonic
1084113554 11:67028663-67028685 CCCACCAATTCCCAACCCCTCGG - Intronic
1085503343 11:77041447-77041469 CCCGCCAATAATCACCCCCACGG + Exonic
1089680147 11:120114893-120114915 CCCCCACATTATCACCCCAATGG + Intronic
1091590113 12:1837714-1837736 CCCTACACTTATCACCACCTGGG - Intronic
1097030099 12:56083668-56083690 ATCCCCAAAGATCACCCCCTTGG - Intronic
1098156848 12:67608367-67608389 CACTCCAAATATCAGCCCCTAGG - Intergenic
1099764789 12:86969872-86969894 CTCACCAATTAGCAACCCCTGGG + Intergenic
1101691896 12:107090599-107090621 GCCCCCAATTCTCACCCTGTTGG - Intronic
1102998642 12:117368375-117368397 CCTCCCCATTATCCTCCCCTAGG - Intronic
1103911266 12:124353974-124353996 TCCCCCAGTCATCACCCCATCGG + Intronic
1107151632 13:37118290-37118312 ACCCTAAATTATCACACCCTGGG - Intergenic
1107817006 13:44253485-44253507 CCACCCAAATATCACCCCGGGGG - Intergenic
1108701035 13:52944483-52944505 TCCCCCAATTATCTCCCATTGGG + Intergenic
1112089250 13:96065317-96065339 CCCCCAAATTATCAAGCCTTTGG - Intergenic
1116420429 14:44726228-44726250 CCTCCTAATCATCACACCCTTGG + Intergenic
1117803359 14:59466148-59466170 CCCCCCATTTATCAGCCAGTAGG - Intronic
1118627593 14:67673939-67673961 CCCCCAAATTATGACTCCTTTGG + Intronic
1122806016 14:104257554-104257576 CCTGCCAATTCTCACCACCTTGG - Intergenic
1130394984 15:83493895-83493917 CCCCCCAATTATAACACCCCTGG - Intronic
1132608931 16:805527-805549 CACCCCACTTACCACCCCATGGG + Exonic
1132814148 16:1817936-1817958 CGCCCCACTTCTCACCACCTGGG + Intronic
1132917705 16:2361924-2361946 CCCCCCAACTACCACCTCATAGG - Intergenic
1134231146 16:12431321-12431343 CCCTCCAATTAACAGCCCCAGGG + Intronic
1137424138 16:48363330-48363352 CCCCCAAATTATCACCAGCCAGG + Intronic
1138541033 16:57687705-57687727 CTCCCCAACCATCAACCCCTGGG - Intronic
1140278242 16:73530268-73530290 CCCCCTACTTATCTCCCACTGGG + Intergenic
1142246452 16:88972320-88972342 CCCCCCAACTATCTCCCCACCGG - Intronic
1142977884 17:3656237-3656259 CCCACCAGTCCTCACCCCCTGGG + Intronic
1146641710 17:34546834-34546856 CCCCTCAATTCTCATCCCCCCGG - Intergenic
1148620706 17:49032432-49032454 CCCCACAACTATCACCAGCTAGG - Intronic
1153053861 18:926367-926389 CCCCCCTATTGTCACCCCTTTGG - Intergenic
1159894127 18:73980588-73980610 CACCTCAAATATCACCCACTGGG + Intergenic
1160436141 18:78854318-78854340 CTCCCCCATCATCACCCACTGGG + Intergenic
1160436177 18:78854474-78854496 CTCCCCCATCATCACCCACTGGG + Intergenic
1162133815 19:8543521-8543543 CCCCCCGATTAACACCAGCTTGG - Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1166824381 19:45600165-45600187 CCCCTAAATTCTCACCACCTGGG + Intronic
1166892462 19:46001751-46001773 CTCCCAAATTACCACCCCCCAGG - Intronic
1168411637 19:56143872-56143894 CCATGCAATTATTACCCCCTTGG - Intronic
934930309 2:98416911-98416933 CCCACCCATTATCTCCCCCTGGG + Intergenic
936506325 2:113110546-113110568 CCCCTCAATTATGACTCCCGAGG + Intronic
938727048 2:134118639-134118661 GCCCCAAATTATCAGCCACTTGG - Intergenic
939171467 2:138701186-138701208 CACCCCACTTCTCACCCACTTGG - Intronic
945826470 2:214725977-214725999 CTCCCCAAATATCATCCTCTAGG + Exonic
948388916 2:237598268-237598290 CTCCCCCATTGTCCCCCCCTTGG + Intronic
1171987118 20:31668210-31668232 CCCCTCAAATGTCACCTCCTAGG + Intronic
1172125863 20:32624854-32624876 CCCACCCCTTACCACCCCCTGGG + Intergenic
1178674069 21:34615509-34615531 CTCCCCAGTTATCACCCCAAGGG - Intergenic
1180074072 21:45453849-45453871 CCCCCCAATATACACCTCCTGGG - Intronic
1180996041 22:19965803-19965825 CCTCCCAATGCCCACCCCCTTGG - Intronic
1184796553 22:46736611-46736633 CACCCCAAATATCACCCACCAGG - Intronic
953812940 3:46130021-46130043 CCCACCACTCCTCACCCCCTTGG - Intergenic
954870081 3:53761182-53761204 CCTCCCACTTTTCACCCTCTAGG - Intronic
963182082 3:142368566-142368588 CCCCCCAATTTTAACCCATTTGG - Intronic
963420674 3:145057143-145057165 CACCCCTATTATCACCCATTGGG + Intergenic
967042422 3:185705862-185705884 GCCCCTAAATATCACCACCTTGG + Intronic
968286593 3:197512651-197512673 ACCCCAAATTATCACCGCATCGG - Intronic
975938810 4:79615161-79615183 CTCCCCAAGTATCACACTCTAGG - Intergenic
992030229 5:72713676-72713698 GCCCCCAATTCTCAGACCCTTGG + Intergenic
994345457 5:98680239-98680261 CCCACCCATTATCAACCCATAGG - Intergenic
999812013 5:155136626-155136648 CCTCCCACTTCTCACCCCATGGG + Intergenic
1002908949 6:1473465-1473487 CCCCTCACTTAGCGCCCCCTCGG + Intergenic
1005369778 6:25120179-25120201 CCCCCCATACCTCACCCCCTGGG + Intergenic
1006588938 6:35140694-35140716 CCCCACACTAAGCACCCCCTAGG + Intronic
1006812466 6:36828783-36828805 GCCCCCACTTTTCACCCCCAAGG - Intronic
1007009406 6:38400631-38400653 CACTCCAATCATCACTCCCTAGG + Intronic
1007317504 6:41001002-41001024 CCAGCCAATTTCCACCCCCTTGG - Intergenic
1012647479 6:101704347-101704369 CCACCTAATTTTCACCCCCTTGG - Intronic
1014254163 6:119144804-119144826 CCACCCATCTACCACCCCCTAGG - Intronic
1024616658 7:51120630-51120652 CTCCCCAATTCCCACCCCCCAGG + Intronic
1029329307 7:99838473-99838495 CCCCTGAATTATCACCACCATGG - Intronic
1029482087 7:100819542-100819564 GCCCCCAAGTCTCACCCTCTCGG + Exonic
1029622733 7:101700078-101700100 CACCCCAGCCATCACCCCCTTGG + Intergenic
1030247241 7:107396520-107396542 CCCCCCACTCCTCACCCCCCTGG - Intronic
1032504779 7:132426735-132426757 CCCTCTAATTTTCACCCTCTGGG - Intronic
1038263666 8:26019895-26019917 CTCCCCACTTCTCAACCCCTGGG - Intronic
1038312535 8:26455532-26455554 CCCCCCAATTATCACCCCCTGGG - Intronic
1040459755 8:47635833-47635855 CTGCCCAATTTTCACCCACTGGG - Intronic
1044716249 8:95102458-95102480 CCCCCCACTCCTGACCCCCTGGG + Intronic
1045009047 8:97941999-97942021 CACCCCAGTTATCATCCCTTGGG + Intronic
1047764688 8:127980871-127980893 CACTGCAATTTTCACCCCCTGGG + Intergenic
1048631868 8:136251926-136251948 CACCCCACTTCTCACACCCTAGG - Intergenic
1049340284 8:142108784-142108806 CCCCTCAATCCTCTCCCCCTGGG + Intergenic
1053481243 9:38418073-38418095 CACCCCAAACATCACCCCCAGGG + Intronic
1185744413 X:2560513-2560535 CCACCCATTTTGCACCCCCTGGG - Intergenic
1186449565 X:9660892-9660914 ACCCCCAAATACCATCCCCTTGG - Intronic
1189403672 X:40696880-40696902 CTCCCCAATTCTAAACCCCTGGG + Intronic
1198082057 X:133249445-133249467 CCCCCCAACCCCCACCCCCTTGG + Intergenic
1199628387 X:149760293-149760315 CCTACCTATCATCACCCCCTTGG - Intergenic