ID: 1038315684

View in Genome Browser
Species Human (GRCh38)
Location 8:26482586-26482608
Sequence CTCATTTACCTGCAGTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038315684_1038315687 -5 Left 1038315684 8:26482586-26482608 CCCATGGACTGCAGGTAAATGAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1038315687 8:26482604-26482626 ATGAGATGATCCTCCTGGAATGG No data
1038315684_1038315690 4 Left 1038315684 8:26482586-26482608 CCCATGGACTGCAGGTAAATGAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1038315690 8:26482613-26482635 TCCTCCTGGAATGGGCTGGCAGG No data
1038315684_1038315688 -4 Left 1038315684 8:26482586-26482608 CCCATGGACTGCAGGTAAATGAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1038315688 8:26482605-26482627 TGAGATGATCCTCCTGGAATGGG No data
1038315684_1038315686 -10 Left 1038315684 8:26482586-26482608 CCCATGGACTGCAGGTAAATGAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1038315686 8:26482599-26482621 GGTAAATGAGATGATCCTCCTGG No data
1038315684_1038315692 5 Left 1038315684 8:26482586-26482608 CCCATGGACTGCAGGTAAATGAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1038315692 8:26482614-26482636 CCTCCTGGAATGGGCTGGCAGGG No data
1038315684_1038315694 29 Left 1038315684 8:26482586-26482608 CCCATGGACTGCAGGTAAATGAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1038315694 8:26482638-26482660 GACTCTCTCGTAGACAAGTCAGG No data
1038315684_1038315689 0 Left 1038315684 8:26482586-26482608 CCCATGGACTGCAGGTAAATGAG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1038315689 8:26482609-26482631 ATGATCCTCCTGGAATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038315684 Original CRISPR CTCATTTACCTGCAGTCCAT GGG (reversed) Intronic
900950035 1:5853383-5853405 ATCATTCAGCTGGAGTCCATGGG - Intergenic
901471604 1:9460429-9460451 CTCACTGTCCTGCAGTCCAGGGG - Intergenic
912110838 1:106340339-106340361 CTCCTTCAACTGCAATCCATTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915778751 1:158521608-158521630 CTGAATTACCTCCAGTACATTGG - Intergenic
916203467 1:162293758-162293780 CTCTTCTACCTGCAGTCCCATGG - Intronic
916302207 1:163288267-163288289 CCCAACTACCTGAAGTCCATTGG - Intronic
919327763 1:196130812-196130834 CACCTGTACCTGCAATCCATTGG - Intergenic
920531660 1:206706825-206706847 AGCATTTACCTGCAGCCCCTCGG + Intronic
922675048 1:227544598-227544620 CACATGTACCTGCATCCCATAGG - Intergenic
1064813953 10:19235105-19235127 TGCATTGACCTGCAGGCCATGGG + Intronic
1070625268 10:78046654-78046676 CTCATTTACCTGCACTCGGAGGG + Intronic
1070869061 10:79732070-79732092 ATCATTTACCTGCAGGTCCTTGG + Intergenic
1071607638 10:87008493-87008515 CCCATTTGCAAGCAGTCCATGGG + Intergenic
1071635973 10:87254255-87254277 ATCATTTACCTGCAGGTCCTTGG + Intergenic
1071659268 10:87483689-87483711 ATCATTTACCTGCAGGTCCTTGG - Intergenic
1071809085 10:89158895-89158917 TTCATTTACCTGAAATCCACTGG - Intergenic
1071962894 10:90823856-90823878 CTCTTTTTCCTGCTGGCCATGGG + Intronic
1081074382 11:38651637-38651659 TTCACTTACCTCCAGTCCCTAGG + Intergenic
1082850489 11:57760125-57760147 CTCATTTGGCAGCAGTCTATAGG + Intronic
1084303226 11:68264810-68264832 TTCAGGGACCTGCAGTCCATGGG + Intronic
1085041598 11:73329875-73329897 CTCATTTTGCTGCTGTCCATGGG + Intronic
1089743351 11:120600169-120600191 CTCATTTTTCTGCAGGCCTTAGG - Intronic
1100278307 12:93092833-93092855 ATCATTTGCCTGCAGTGGATTGG - Intergenic
1111232983 13:85368653-85368675 TTCATTTACCTGCATTGCAGTGG + Intergenic
1115460815 14:33658621-33658643 CTCCTTAACCTGGAGCCCATAGG + Intronic
1115778249 14:36740053-36740075 CTCACTTGGCTGCAGTCCACAGG - Intronic
1116805048 14:49485684-49485706 CTCTTTTCTCTCCAGTCCATGGG + Intergenic
1119962196 14:78871828-78871850 CCCATTTACCTGTTGTCCTTTGG + Intronic
1120894722 14:89519245-89519267 TTCATTTCCCTGCCGTCCAGAGG + Intronic
1121061262 14:90912287-90912309 ATCAATTCCCTGCAGTCCGTGGG + Intronic
1121065810 14:90963709-90963731 CCCATTTACCTGGAGTTGATTGG - Intronic
1121445360 14:93975276-93975298 CTCATTTACCTGCCCTCCCTAGG + Intronic
1121856548 14:97275769-97275791 CACATTTACCTGAATTCCAATGG + Intergenic
1125110714 15:36029422-36029444 CTCAGTCCCCTTCAGTCCATTGG + Intergenic
1127309878 15:57743213-57743235 CTCACTGACCTGCTTTCCATGGG + Intronic
1128402276 15:67295629-67295651 CTCATGTACCTGAAGTCCAGAGG - Intronic
1129149017 15:73675788-73675810 CTCATTTACCTGTATTGCAGTGG - Intergenic
1130231551 15:82101107-82101129 CTCAATTACCTGCAGCTCAGAGG - Intergenic
1132758115 16:1495830-1495852 CTCTTGTCCCTGCAGTCCCTTGG + Intronic
1135158919 16:20076193-20076215 CTCATCTCCCTGCAGGCCCTGGG - Intergenic
1135191156 16:20355952-20355974 CAGATTTACCTGCATTCCTTGGG + Intronic
1137805292 16:51298955-51298977 CTGCTATAGCTGCAGTCCATGGG - Intergenic
1139194331 16:64901034-64901056 TTCTTTCATCTGCAGTCCATGGG - Intergenic
1143252699 17:5534863-5534885 CTCACTGACCTCTAGTCCATCGG + Intronic
1144100294 17:11937028-11937050 CTCTTTTTCCTGCAGACCAGAGG - Intronic
1149734976 17:58985600-58985622 CTCACTTATCAGCAGTCCTTGGG - Intronic
1156956525 18:42971846-42971868 CTCATCTGCCTGCATTCCATTGG + Intronic
1158232396 18:55272192-55272214 CTGATTTACATGGATTCCATTGG - Intronic
1159214533 18:65373232-65373254 CTAATTTACCTGAAGTCCCCTGG + Intergenic
1161631470 19:5358781-5358803 CTGATTTACCTTCAGACCTTGGG - Intergenic
1161730035 19:5954201-5954223 CTCTTTTACTTGCACCCCATCGG + Intronic
1162070572 19:8149742-8149764 CTCACATCCCTCCAGTCCATCGG - Exonic
1163204821 19:15794820-15794842 GTCATTTACCTGAAGCCCAAAGG + Exonic
1163935706 19:20441308-20441330 ATGATTTCCCTGCATTCCATAGG + Intergenic
1167415734 19:49370763-49370785 ATCATTTACCTGGACTCCCTAGG - Intronic
1167470670 19:49674292-49674314 CTCATCTACCTACAGACCAGTGG + Intergenic
926627154 2:15101789-15101811 CTCATTTTCCTGCATTCTAGAGG + Intergenic
927692119 2:25215819-25215841 CACCTTTACCTGGAGTCCCTTGG - Intergenic
932962324 2:76428130-76428152 CTCCTTGAGTTGCAGTCCATAGG + Intergenic
938225529 2:129612737-129612759 CCCATTTTCCTGCATTCCTTGGG + Intergenic
941560708 2:167040769-167040791 CTCTTTCACCTGCAGACCCTAGG + Intronic
941579190 2:167273789-167273811 CACTTTTACCTGCATTTCATTGG + Intergenic
945548003 2:211182049-211182071 CTCATTTGCCTTCATTCCAAGGG + Intergenic
947296668 2:228638261-228638283 TTCAGTTACCTGCAGTCAAATGG - Intergenic
948036989 2:234865715-234865737 CTCAGTTACATGCAGGCCATGGG - Intergenic
1179725920 21:43341191-43341213 CTCAATTAGCTGGAGTCCTTTGG + Intergenic
951056452 3:18151865-18151887 CTCATCTACCTGCATTCCATTGG + Intronic
952192163 3:31035286-31035308 CTCATTTCCCTGCTGCCCAGAGG - Intergenic
952526855 3:34219764-34219786 CTCATTTTCCTGATGTCCCTAGG + Intergenic
953907958 3:46877830-46877852 CCCACTCACCTGCAGCCCATGGG - Intronic
957146624 3:76433109-76433131 CTCATATATCTGCAGTTAATTGG + Intronic
958609563 3:96407417-96407439 CTCATTTACCAACATTCCATAGG + Intergenic
961097612 3:124171293-124171315 CTCATGTAGCTGCAGTCATTTGG + Intronic
962745634 3:138395773-138395795 CTCATTCGCCTTCTGTCCATAGG + Intronic
962961737 3:140317445-140317467 CTCCCTTAGCTGCAGTCCACTGG + Intronic
964941640 3:162164569-162164591 AACATTTACCAGCAGACCATTGG - Intergenic
965842589 3:172924195-172924217 CTCATATACCTACATTCAATTGG + Exonic
965961287 3:174431283-174431305 CTCATTTACCTGCTGTCTCTGGG + Intergenic
966389299 3:179435008-179435030 CTCTTGTACCTGAAGTCCACTGG + Intronic
971041240 4:22754564-22754586 CTCCTTTACCTGCTCTCCGTGGG - Intergenic
977552786 4:98459787-98459809 CTCATTTATCTGCAGTGCAGAGG - Intergenic
983194377 4:164789337-164789359 CTCCTTTATCTACACTCCATAGG + Intergenic
986740879 5:10704113-10704135 CTCTTTTACCTGGAGCCCTTGGG + Intronic
993962732 5:94319935-94319957 CTCATTTAGCTCCAGTCCTAAGG + Intronic
997098334 5:130939310-130939332 CTTATTTACATCCAGTCCAGTGG + Intergenic
997409148 5:133677301-133677323 GTCATTTAGCTGGATTCCATGGG + Intergenic
997457282 5:134026705-134026727 CTCATTAAGCTCCAGTCCACAGG - Intergenic
999042340 5:148427921-148427943 CTCAGATACCAGCAGTACATGGG - Intronic
1001283383 5:170404485-170404507 CTCATGTACTTGCAGTCAGTCGG + Intronic
1001460988 5:171914182-171914204 CTAATTTATCTTCATTCCATAGG - Intronic
1003848979 6:10202652-10202674 CCACTTTACCTACAGTCCATTGG - Intronic
1006873933 6:37278996-37279018 CTCATTTCTCCTCAGTCCATTGG + Intronic
1007658304 6:43466314-43466336 CTCATATAGCTGCAGTCAGTCGG - Intergenic
1008979044 6:57462440-57462462 CTCATTTATCTAATGTCCATGGG - Intronic
1013494244 6:110682332-110682354 TTCATTTACCTTCAGTTCTTTGG - Intronic
1021887486 7:25154054-25154076 CTTACTCACCTGCGGTCCATGGG - Intronic
1022904418 7:34841913-34841935 CTTCTTTACTTGCAGCCCATGGG + Intronic
1028864599 7:95693088-95693110 CTCATTTACCTCCAGACCCACGG + Intergenic
1030456922 7:109786288-109786310 CTCATTTTACTGCAGTCATTCGG + Intergenic
1034722747 7:153309716-153309738 CTGACTTCCTTGCAGTCCATCGG + Intergenic
1035084071 7:156241235-156241257 CTCATCTACCTGCAATCACTGGG + Intergenic
1038315684 8:26482586-26482608 CTCATTTACCTGCAGTCCATGGG - Intronic
1038373587 8:27015728-27015750 TTCACTTACCTCCACTCCATGGG + Intergenic
1038697841 8:29821757-29821779 CTCGTCTACCTGCTGACCATGGG - Intergenic
1039304331 8:36244706-36244728 GTCATTTGCTTTCAGTCCATTGG - Intergenic
1040630612 8:49205782-49205804 CTCATTTACCTGTGGTCACTGGG - Intergenic
1042816417 8:72882328-72882350 CTCACTTACTTGCATTCCAAGGG - Intronic
1043308790 8:78832130-78832152 CTCATTTACCAGCATACTATTGG + Intergenic
1048653199 8:136504338-136504360 ATTATTTTCCTGCAGTCCAGTGG + Intergenic
1049310006 8:141928791-141928813 CTCAGCTGCCTGCAGTGCATGGG - Intergenic
1050389606 9:5126253-5126275 CTCAATTTCCTCCAGTCAATGGG - Intronic
1051818387 9:21135744-21135766 CTCATTTATCTGCAGCCATTGGG - Intergenic
1052107663 9:24539101-24539123 CACTTTTACCCACAGTCCATTGG + Intergenic
1052222216 9:26039133-26039155 CTCATTTAACTCCAGCCCCTTGG - Intergenic
1053311450 9:37023392-37023414 CTCACCTAACTGGAGTCCATAGG - Intronic
1055179130 9:73361406-73361428 CTGCTTTACCTGGAGTCAATAGG - Intergenic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1055862495 9:80769551-80769573 CTCATATACCTGCAGGCTCTGGG + Intergenic
1057904347 9:98972773-98972795 CTCATCTGTCTGCAGTCCAGTGG - Intronic
1185872112 X:3673168-3673190 CTCATTCACCTGCTGTCCCCGGG - Intronic
1187092862 X:16115731-16115753 TTCATTTACCTACTGTCTATTGG + Intergenic
1187794841 X:22992661-22992683 GTAATTTTCCTGAAGTCCATTGG + Intergenic
1189307481 X:39997718-39997740 CACATTTACTTGTATTCCATTGG - Intergenic
1190471877 X:50789480-50789502 CTGATTTTGCTGCATTCCATCGG - Intronic
1194759000 X:97771692-97771714 CTTATGTACCTGCATTCCACAGG + Intergenic
1194797402 X:98228621-98228643 CTAATTTACCTGTACTCCATTGG + Intergenic
1194977114 X:100407398-100407420 CTCATATTCCTGCAGTCGAAAGG + Exonic
1195252257 X:103060657-103060679 TTATTTTACCTGCACTCCATAGG + Intergenic
1196603737 X:117631499-117631521 CTCCTCTACCTACATTCCATTGG - Intergenic
1200106304 X:153715130-153715152 CACTTTTACCTGCTGTCCCTAGG + Intronic
1200686409 Y:6263713-6263735 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1200691319 Y:6307910-6307932 CTCATTCCACTGCAGTCCAGTGG + Intergenic
1200791774 Y:7305511-7305533 CTCATTCACCTGTAGTCCCCAGG + Intergenic
1200831710 Y:7692376-7692398 CTCATTCCACTGCAGTCCAGTGG + Intergenic
1200887258 Y:8281909-8281931 CTCATTCCACTGCAGTCCAGTGG + Intergenic
1200951135 Y:8901480-8901502 CTCATTCCACTGCAGTCCAGTGG - Intergenic
1200989284 Y:9334630-9334652 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1200991950 Y:9354960-9354982 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1200994604 Y:9375240-9375262 CTCATTCCACTGCAGTCCAGCGG - Intronic
1200997267 Y:9395586-9395608 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1200999782 Y:9464123-9464145 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1201002440 Y:9484432-9484454 CTCATTCCACTGCAGTCCAGCGG - Intronic
1201005100 Y:9504719-9504741 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1201007758 Y:9525046-9525068 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1201010379 Y:9545236-9545258 CTCATTCCACTGCAGTCCAGCGG - Intergenic
1201018287 Y:9626073-9626095 CTCATTCCACTGCAGTCCAGTGG + Intergenic
1201043953 Y:9866806-9866828 CTCATTCCACTGCAGTCCAGTGG - Intergenic
1202110104 Y:21409048-21409070 CTCATTCCACTGCAGTCCAGTGG + Intergenic
1202115201 Y:21465310-21465332 CTCATTCCACTGCAGTCCACCGG - Intergenic
1202161692 Y:21941268-21941290 CTCATTCCACTGCAGTCCAGTGG + Intergenic
1202196798 Y:22306036-22306058 CTCATTCCACTGCAGTCCAGTGG - Intergenic
1202229664 Y:22645105-22645127 CTCATTCCACTGCAGTCCAGTGG - Intergenic
1202313492 Y:23551060-23551082 CTCATTCCACTGCAGTCCAGTGG + Intergenic
1202557311 Y:26119535-26119557 CTCATTCCACTGCAGTCCAGTGG - Intergenic