ID: 1038315835

View in Genome Browser
Species Human (GRCh38)
Location 8:26483673-26483695
Sequence AGCGTGGACAAACAATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038315835_1038315837 7 Left 1038315835 8:26483673-26483695 CCTGGTCATTGTTTGTCCACGCT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1038315837 8:26483703-26483725 GCATCAAAGACATTGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038315835 Original CRISPR AGCGTGGACAAACAATGACC AGG (reversed) Intronic
906288214 1:44602299-44602321 AGGGTGGAGAAGCAATGAGCTGG + Intronic
909602388 1:77474029-77474051 AGGCTGGACAAACAATAAGCAGG + Intronic
912586409 1:110771012-110771034 AGTGAGGACAAACATTGCCCTGG + Intergenic
917463513 1:175253762-175253784 AGTGAGGACAAACAATGAAATGG - Intergenic
924470701 1:244340300-244340322 AGCATGTACAAACATTTACCAGG + Intergenic
1067944422 10:50681213-50681235 AGCGTGCACACAGAATGACCTGG - Intergenic
1070865922 10:79708084-79708106 AGCGTGCACACAGAATGACCTGG - Intronic
1070879716 10:79846215-79846237 AGCGTGCACACAGAATGACCTGG - Intronic
1071132588 10:82412178-82412200 AGAGTGGGCAAATAATGACAGGG + Intronic
1071632822 10:87230305-87230327 AGCGTGCACACAGAATGACCTGG - Intronic
1071646271 10:87362523-87362545 AGCGTGCACACAGAATGACCTGG - Intronic
1072086311 10:92082831-92082853 AGGGAAGACAGACAATGACCTGG + Intronic
1083650587 11:64201798-64201820 AGCGTGGAGAAAGAATGAATGGG + Intronic
1099402510 12:82216730-82216752 AGCATGGCCAAGCAATGCCCAGG + Intergenic
1109014452 13:56991770-56991792 AGCTTGGACACAATATGACCTGG - Intergenic
1128725894 15:69988460-69988482 AGCCAGGACCAACAAGGACCTGG + Intergenic
1131958285 15:97761635-97761657 ATCGTGGACATAAAAGGACCTGG + Intergenic
1132549599 16:548849-548871 AGCGTGGACAGCCACAGACCTGG - Intronic
1136058211 16:27706498-27706520 AGCGGGGACAATGAATGACAGGG + Intronic
1138331791 16:56221263-56221285 AGCATGGACAGACTATGACAGGG + Intronic
1155565548 18:27130031-27130053 AGCATGGAAAAACAATTAGCAGG + Intronic
1157508391 18:48248526-48248548 TCAGAGGACAAACAATGACCAGG - Intronic
1158045311 18:53148423-53148445 AGAATGGATAAACAATGACTGGG + Intronic
1166420664 19:42633652-42633674 AGGATGGACATTCAATGACCCGG + Intronic
925315607 2:2920726-2920748 ATCATGAACAAACAATGACAGGG + Intergenic
935312838 2:101802491-101802513 AGGGTGGAGAAACAGTGAACAGG - Intronic
939157772 2:138545003-138545025 AGCTGGCACAAGCAATGACCAGG - Intronic
946196288 2:218034553-218034575 AGCCTGGAGAAACGAGGACCCGG + Intergenic
946579487 2:221112140-221112162 AACATGGACAACCAATGAGCAGG + Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169709624 20:8547158-8547180 AGCCTGAAGAAACAATGAGCTGG - Intronic
1175489183 20:59367513-59367535 AGAGTGAACAAAGAATGATCAGG + Intergenic
1182774330 22:32819660-32819682 AGTCTGGACAATCAAGGACCTGG + Intronic
951366868 3:21794045-21794067 AGAGAGCACAAAGAATGACCAGG + Intronic
954602384 3:51879523-51879545 AGCCTGGACAAACTAAGACAGGG + Intergenic
956390386 3:68766068-68766090 AGAATGGAGAAACAATGACAAGG + Intronic
970823981 4:20252158-20252180 AGCGTAGCCAAACAAAAACCCGG - Intergenic
974173808 4:58299572-58299594 AGGGGGGATAAACAATGACAAGG - Intergenic
979382101 4:120019262-120019284 AGAAGGGACAAACACTGACCTGG + Intergenic
990742215 5:58923510-58923532 AGCCTGCCCAAACAAAGACCAGG + Intergenic
999851442 5:155544073-155544095 AGCGTGGACAATCTATGTCTTGG + Intergenic
1021988058 7:26116363-26116385 AGTGAGGAGAAAAAATGACCTGG - Intergenic
1023217341 7:37877688-37877710 ACCCTGGACAAAGAATGATCTGG - Intronic
1024152743 7:46589270-46589292 TGTGTGTACAAACAATGAGCTGG + Intergenic
1024157001 7:46636244-46636266 AGTGTGCACAGACACTGACCTGG + Intergenic
1024941736 7:54769687-54769709 AGGCTGGGCTAACAATGACCAGG + Intergenic
1038315835 8:26483673-26483695 AGCGTGGACAAACAATGACCAGG - Intronic
1039613595 8:38937813-38937835 AGAGTTAACAAATAATGACCTGG - Intronic
1046526912 8:115392476-115392498 AGGATTGACAAACAATGACAGGG + Intergenic
1047118007 8:121867077-121867099 AACTTAGACGAACAATGACCAGG - Intergenic
1050458134 9:5853573-5853595 GGCCTGGAGAAACAAGGACCAGG + Intergenic
1051231795 9:14962816-14962838 AGTGTGGAAACACAATGGCCTGG - Intergenic
1055627770 9:78192122-78192144 AGGGTCAACAAACAATGATCAGG + Intergenic