ID: 1038318413

View in Genome Browser
Species Human (GRCh38)
Location 8:26507635-26507657
Sequence CTGTGGGTCCTGCCCCCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 1, 2: 8, 3: 40, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038318404_1038318413 23 Left 1038318404 8:26507589-26507611 CCCATACATTAAAGAAAAAAATT 0: 1
1: 0
2: 16
3: 198
4: 1658
Right 1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG 0: 1
1: 1
2: 8
3: 40
4: 343
1038318405_1038318413 22 Left 1038318405 8:26507590-26507612 CCATACATTAAAGAAAAAAATTT 0: 1
1: 0
2: 9
3: 175
4: 1661
Right 1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG 0: 1
1: 1
2: 8
3: 40
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038318413 Original CRISPR CTGTGGGTCCTGCCCCCAGG TGG Exonic
900183403 1:1322270-1322292 CTGTGGGTCCTGTCGGGAGGCGG - Intronic
900322445 1:2091818-2091840 CCGAGGGCCCTGACCCCAGGCGG + Intronic
900350736 1:2233299-2233321 CCGGGGGTCCTGCTCCGAGGGGG + Intronic
900880501 1:5377956-5377978 GTGTGAGTCCTGCTCTCAGGGGG + Intergenic
902181597 1:14693333-14693355 CTGTGGTTCCTTCCTCCTGGTGG - Intronic
902823163 1:18955893-18955915 CTGGGCGGCCTGCCCCCCGGCGG - Exonic
903655037 1:24943759-24943781 CTGAGGACCCTGCCCTCAGGGGG - Intronic
903878506 1:26492687-26492709 CTGTCCGTCCTGACCTCAGGAGG - Intergenic
904374763 1:30073478-30073500 CTCTGGGTTCTGCCCCCAAATGG - Intergenic
905243536 1:36596769-36596791 CAGACAGTCCTGCCCCCAGGGGG + Intergenic
906242200 1:44248922-44248944 CCGTGTGTCCCCCCCCCAGGTGG - Intronic
906266179 1:44431956-44431978 CTCTGGGTCCTGCTCCCAGTTGG + Intronic
906315929 1:44786418-44786440 CTGGGGGTCCGGCCCACAGCCGG - Intronic
907564490 1:55422199-55422221 CTGTGGGCCATGCCTGCAGGTGG - Intergenic
911571539 1:99523366-99523388 CTGTGGGGCCTGCCACAGGGTGG - Intergenic
912557724 1:110528372-110528394 CTGTGGGATCTGCCTCCATGAGG + Intergenic
912714291 1:111971476-111971498 CTCTGGCACCTGCCCCCAGTAGG - Intronic
912809236 1:112781337-112781359 CTGTGGGCCCTGGCACCAGCAGG + Intergenic
913512443 1:119574001-119574023 CTGTGGGTGCAGCCCACAGAGGG + Intergenic
914825440 1:151135651-151135673 CTGAAGGTGCTGACCCCAGGTGG - Exonic
915135405 1:153728150-153728172 CTTTGGATCCGGCCCCTAGGGGG - Exonic
915892659 1:159785667-159785689 CTGGGGCTCCTGTCCACAGGAGG + Intergenic
916787042 1:168093893-168093915 CTGAAGGTCCTGATCCCAGGAGG - Intronic
919766245 1:201129121-201129143 CTCTGATTCCTGCCTCCAGGTGG - Intergenic
919870785 1:201819775-201819797 CTCTGGGTCCTGCCCACAGAAGG - Intronic
920066557 1:203273581-203273603 CTGTGGGTCCTCCCCGCTGCAGG - Intronic
920186490 1:204162552-204162574 CTGTCTGTCCTCCCGCCAGGTGG - Intronic
920725754 1:208433368-208433390 CTTGATGTCCTGCCCCCAGGAGG - Intergenic
921033770 1:211356904-211356926 CTGTGGGACCTGGCCTCATGGGG + Intronic
922799059 1:228355921-228355943 CAGTGGGTCCTGCCTTCACGAGG + Intronic
924180064 1:241431244-241431266 CAGTGGGTGCAGCCCCCAGAGGG - Intergenic
924473437 1:244363554-244363576 CTCTGGGTGGGGCCCCCAGGAGG + Intronic
1063959879 10:11298252-11298274 CTGTGGGGGCTCCTCCCAGGGGG - Intronic
1070305873 10:75238843-75238865 CTGAGGGCCCTGCGCTCAGGTGG + Intergenic
1071984460 10:91036608-91036630 CTGTGGCTTCTACCCCCAGAGGG - Intergenic
1073582167 10:104678629-104678651 ATGTGGTCCCTGCCCTCAGGAGG - Intronic
1074770952 10:116733393-116733415 CAGTGGTTCCTGTACCCAGGCGG - Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1075661407 10:124199536-124199558 CTGGGGCTCCTGTCTCCAGGTGG + Intergenic
1075719784 10:124577925-124577947 CTGTGTGTGCTGCACCGAGGTGG - Intronic
1076479394 10:130775012-130775034 CTGTGGGTGCTGGCTGCAGGTGG - Intergenic
1076657311 10:132033296-132033318 CTGTGAGTCCAACTCCCAGGGGG + Intergenic
1076679218 10:132163101-132163123 CTCTTGGCCCTGCTCCCAGGCGG + Intronic
1076790298 10:132773661-132773683 CTGTGGGACCTGTGCCGAGGGGG + Intronic
1077047357 11:552425-552447 CTGTGTGTCCTGTCCCGTGGGGG + Intronic
1077078135 11:710375-710397 CTGTGGGTCCTGCCCGTCGGGGG + Intronic
1077092695 11:786893-786915 CTGTGGGTCCTGACCCAAGATGG - Intergenic
1077184689 11:1230828-1230850 CTGTGGGCTCTGTCCCCAGTGGG + Intronic
1077369203 11:2173709-2173731 CTGTGGGTCCTGCCCACAGTAGG + Intergenic
1077500515 11:2907958-2907980 CTCTGGGGCGTGCCCCCAGAGGG + Intronic
1078617859 11:12881772-12881794 CTGTGGTCCCTGCCTGCAGGTGG - Intronic
1078809515 11:14743874-14743896 CAGTGGGTCCAGCCCACAGAGGG - Intronic
1083253246 11:61481783-61481805 CTGTGGGGCAGGGCCCCAGGGGG - Exonic
1083674811 11:64319315-64319337 CTGAGGGTCCCACCCTCAGGAGG - Intronic
1083726844 11:64632981-64633003 GTTTGGGGGCTGCCCCCAGGGGG + Intronic
1083731276 11:64653896-64653918 CTGTCCCTCCTGCCCCCAAGAGG + Intronic
1083804555 11:65066257-65066279 CTGTGGGCCCTGGGCTCAGGTGG - Intergenic
1083882625 11:65555933-65555955 CTGTGAGGCCTGGCCCCAAGAGG - Intronic
1084007836 11:66332553-66332575 CTGTGGGCCAGGGCCCCAGGGGG + Exonic
1084189557 11:67492879-67492901 CTGAGGGCCCTGCCCCCTGGTGG + Intronic
1084400784 11:68941759-68941781 CTGTGGGCCGTCCCACCAGGAGG + Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086351142 11:85943889-85943911 CTGTAGGCCCTCCCCCCAGAGGG - Intergenic
1086907329 11:92433169-92433191 CAGTGGATCCTACCCCCATGGGG - Intronic
1087482454 11:98718467-98718489 CAGTGGGTGCAGCCCACAGGGGG - Intergenic
1088926422 11:114307720-114307742 CTGTGTTTCCTGCCACCACGTGG + Intronic
1089671819 11:120062137-120062159 CTGTTGGTTCTGCCCCCTGATGG - Intergenic
1091214176 11:133890371-133890393 CTGAGGGTCCTGGGCCAAGGGGG - Intergenic
1091225011 11:133951785-133951807 CCGTGGGCTCGGCCCCCAGGAGG + Intronic
1091697239 12:2636133-2636155 CAGTGGGCTCTGCCCTCAGGAGG + Intronic
1092793788 12:12091473-12091495 CTGTGGGTTATGGACCCAGGAGG - Intronic
1094215433 12:27936182-27936204 ATAAGGGTCCTGCCTCCAGGAGG - Intergenic
1095720164 12:45392004-45392026 CAGTGGGTGCTGCCCACAGAGGG + Intronic
1101362972 12:104045068-104045090 CTGCCTGTCCTGCCCCAAGGTGG + Intronic
1101802282 12:108032898-108032920 ATGTGGTCCCTGCCCTCAGGGGG - Intergenic
1102009958 12:109612112-109612134 CTGAGGTGCCTGCCGCCAGGTGG - Intergenic
1103054134 12:117805300-117805322 CTGTGTGTCTTGGCCCAAGGTGG - Intronic
1104542563 12:129680888-129680910 CTGTGGGTCCAGCTCCCACCAGG - Intronic
1104853905 12:131893160-131893182 CTGTGTGTCCTGCGGCCTGGAGG + Intergenic
1105719583 13:23100704-23100726 CTGTGGCTCCTGCCAACATGGGG + Intergenic
1106433550 13:29704760-29704782 CTGTGTGTCCTGCCTCTAAGTGG + Intergenic
1106540924 13:30689797-30689819 CCGTGGGTACAGGCCCCAGGGGG - Intergenic
1106595355 13:31130566-31130588 CTGTGTGTTCTGCACACAGGTGG - Intergenic
1106759784 13:32857404-32857426 ATGTGGGCCCTGCCCTCATGTGG - Intergenic
1107401943 13:40077753-40077775 CTGGTGGTCCAGGCCCCAGGAGG - Intergenic
1108081347 13:46739858-46739880 CTGTGTTGCCTGCCCCCATGAGG + Intronic
1108136857 13:47373789-47373811 ATGTGGGTCTTGGCCCCATGTGG + Intergenic
1108508853 13:51136745-51136767 CTGGGGGTCCTGGCCCTGGGCGG - Intergenic
1112507747 13:99985244-99985266 CTGTGGGGCCGGGCCCCTGGGGG - Intronic
1113522053 13:110948040-110948062 AAGTGAGTCCAGCCCCCAGGTGG - Intergenic
1115516194 14:34187634-34187656 CTGTGCCTGCTACCCCCAGGGGG - Intronic
1117305064 14:54465921-54465943 CTCTGGTTTCTGCTCCCAGGAGG - Intergenic
1118773894 14:68961597-68961619 CTGAGGGACCAGCCCCCAGTGGG + Intronic
1119104017 14:71907140-71907162 ATGTGGTTCCTGCCCTCATGAGG + Intergenic
1119193901 14:72702848-72702870 CGGTGGATCCAACCCCCAGGTGG + Intronic
1119390775 14:74289733-74289755 CTGGGGCCCCTGCCCTCAGGAGG - Intronic
1119780424 14:77273335-77273357 CTGTGGGTCATCCGCCCAGGAGG + Intergenic
1120953587 14:90062589-90062611 GGGTCGGTCCTGCCCCCCGGAGG - Intronic
1121254154 14:92519351-92519373 CCATGGGTCCTGCCCCAAAGTGG - Intronic
1121653046 14:95574106-95574128 CTGTGGTTCCATCCCCCAGGGGG + Intergenic
1121756850 14:96410169-96410191 CTGTGGTCCCTGCCCTCAAGGGG - Intronic
1122089666 14:99329998-99330020 CTGTGGGACGTGAGCCCAGGTGG + Intergenic
1122343027 14:101040921-101040943 CTGTCCGTCCTGTACCCAGGAGG - Intergenic
1122569208 14:102683501-102683523 CGGGGGGACCTGCGCCCAGGTGG - Intronic
1122853739 14:104549927-104549949 CTGCAGGTCCTGCCCCCAGAAGG - Intronic
1123135128 14:106021177-106021199 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123145777 14:106128804-106128826 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123159851 14:106267892-106267914 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123161113 14:106278672-106278694 CTGTGGATGCTGCAGCCAGGAGG - Intergenic
1123164506 14:106313899-106313921 CTGTGGCTCCTGCAACCACGTGG - Intergenic
1123481883 15:20639845-20639867 CTGTGGCTGCTGCCACCAAGAGG + Intergenic
1123482111 15:20641589-20641611 CTGTGGATGCTGCAGCCAGGAGG - Intergenic
1123585680 15:21759047-21759069 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123622322 15:22201635-22201657 CTGTGGCTCCTGCAGCCACGTGG - Intergenic
1123636130 15:22360520-22360542 CTGTGGCTGCTGCCACCAAGAGG - Intergenic
1124407239 15:29403975-29403997 CTGCAGGTACTGCACCCAGGTGG + Intronic
1124432386 15:29618781-29618803 CTGTGGGTGCTGCCACCCTGGGG - Intergenic
1126795787 15:52259806-52259828 CTGTTGGACTTGCACCCAGGTGG - Intronic
1128307483 15:66609175-66609197 CTGTGGCACCAGCCCGCAGGTGG + Intronic
1128517905 15:68354777-68354799 CTGTGGGTCCTGGCCACTGATGG - Intronic
1128578431 15:68791807-68791829 CAGTGGGTCTTTCCCCCATGTGG - Intronic
1129461143 15:75700595-75700617 GGGTGGGAGCTGCCCCCAGGAGG + Intronic
1129678221 15:77643706-77643728 CTGTGGGTGCTGCCCTCTGGGGG - Intronic
1129723687 15:77891147-77891169 GGGTGGGAGCTGCCCCCAGGAGG - Intergenic
1129738455 15:77978378-77978400 CTGGGGGTACTGCCACCAGGAGG + Intergenic
1129784960 15:78304014-78304036 CTCTGGGTCCTGCACCTAGGAGG - Intergenic
1129847616 15:78775231-78775253 CTGGGGGTACTGCCACCAGGAGG - Intronic
1129855977 15:78825492-78825514 CTGTGGGGCCTGGCACCTGGAGG - Intronic
1129922252 15:79329258-79329280 CTGTGAGTCATGCTCCCATGAGG - Intronic
1130094738 15:80847545-80847567 CTGGGGGTCCTACTCCCAGGTGG - Intronic
1130254283 15:82318678-82318700 CTGGGGGTACTGCCACCAGGAGG + Intergenic
1130600682 15:85271292-85271314 CTGGGGGTACTGCCACCAGGAGG - Intergenic
1130610148 15:85353877-85353899 ATGTGGTCCCTGCCCTCAGGGGG + Intergenic
1131075081 15:89490360-89490382 CTGTGGGTCCTGCCCCAGGGTGG + Intronic
1132546127 16:534266-534288 CTGTGGCCCCGGCCCCCAGATGG + Intronic
1132663700 16:1072512-1072534 GTGGGGGTCCTGCCGCCAGCAGG - Intergenic
1132669736 16:1097723-1097745 CTCTGGGACCTGCCCTCAAGGGG - Intergenic
1132690813 16:1181099-1181121 CTGTGGGGCCTGCTCCGAGCTGG - Intronic
1133317922 16:4895452-4895474 CTCTGCGTCCTCCCACCAGGGGG - Intronic
1133338315 16:5020874-5020896 CTCTGGGTCCAGGCCCCAGGAGG - Intergenic
1134089684 16:11384867-11384889 CGGTGGGTCTGGGCCCCAGGAGG - Exonic
1134899334 16:17921774-17921796 CTGTCACTCCTGCCCCCTGGTGG - Intergenic
1135752073 16:25066070-25066092 GTGTTGCTGCTGCCCCCAGGTGG - Intergenic
1135757223 16:25108165-25108187 GTGTTGCTGCTGCCCCCAGGTGG + Intergenic
1135953088 16:26933508-26933530 CTCTTGATCCTGCCACCAGGTGG + Intergenic
1136298396 16:29316907-29316929 CTGTGCGTGCTTCCCCCGGGAGG + Intergenic
1136372084 16:29842811-29842833 CCCTGAGTCCTGACCCCAGGAGG - Intronic
1136693329 16:32052995-32053017 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1136793820 16:32996218-32996240 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1137015428 16:35369532-35369554 GTGTGGGTCCTGCCCATAGAGGG - Intergenic
1137353096 16:47731641-47731663 CTGTGGCTCCTCCCCTCATGAGG - Intergenic
1138554840 16:57765101-57765123 CTGTGGCTCCTCCCACCATGTGG - Intronic
1138633631 16:58319386-58319408 CTGTGGGTCCTGCCCCTCACTGG + Intronic
1140228707 16:73099748-73099770 CTGTGTGTCCTGCTCTCAGGAGG + Intergenic
1140473989 16:75229492-75229514 CTGAGGGTGGTGACCCCAGGAGG - Exonic
1141396663 16:83711072-83711094 CAGTGGCACCTGCCCCAAGGTGG - Intronic
1141719263 16:85746604-85746626 TTCTGGGTCCTCCTCCCAGGAGG - Intronic
1141998370 16:87648953-87648975 GTGTGGGTGCTGCCGCCGGGAGG + Intronic
1142186740 16:88698332-88698354 CTGTGGGGGCTGCCTGCAGGTGG - Intronic
1142393335 16:89816568-89816590 CCCTGGGTCCTGGCCCGAGGCGG + Exonic
1203096082 16_KI270728v1_random:1257911-1257933 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1143432107 17:6894865-6894887 CTGTGTGTTCTTCCTCCAGGTGG + Intronic
1144788071 17:17842752-17842774 CTGAGGGGCCTGCTTCCAGGAGG + Intergenic
1145006022 17:19338269-19338291 CTCTGGGCTCTGCCCCCTGGTGG + Intronic
1145207641 17:20993048-20993070 CTGTGGGTGCTGCCTCCTGGTGG + Intergenic
1145797594 17:27664864-27664886 GTGTGGGCCCTGTCCCCTGGTGG + Intergenic
1145875579 17:28316719-28316741 CTGTTTGTCCTGCTCCGAGGGGG - Intergenic
1146279202 17:31534104-31534126 CTCTGGGACCTGCCACCAAGGGG - Exonic
1146517063 17:33497610-33497632 CTGAGGATCCTGCCCCCACTAGG + Intronic
1147437624 17:40427253-40427275 CTGGGTGTGCTGCCTCCAGGTGG - Intergenic
1147935425 17:44007892-44007914 CTGTGTGTTCTGCCCCTGGGAGG - Intronic
1148123759 17:45226452-45226474 ATGTGGGTCCTGGCCCCCAGGGG - Intronic
1151354147 17:73548641-73548663 CAGTGTGCCCTGCTCCCAGGAGG + Intronic
1151434994 17:74089648-74089670 CTGTGGATCCTCCCCCTAAGAGG - Intergenic
1151444797 17:74156224-74156246 CTGAGGCTCCAGCTCCCAGGAGG + Intergenic
1152135863 17:78503008-78503030 CCGTGGCTCCCGTCCCCAGGTGG - Exonic
1152304704 17:79513777-79513799 CTCTGTGTGCTGGCCCCAGGAGG - Intronic
1153514573 18:5891774-5891796 CGGTGGCTGCTGCCCGCAGGCGG + Exonic
1154016529 18:10623546-10623568 CTGTGGTTCCAGCTACCAGGGGG - Intergenic
1154188982 18:12212117-12212139 CTGTGGTTCCAGCTACCAGGGGG + Intergenic
1157472912 18:48003447-48003469 CTGTGGGGCCCTCCTCCAGGAGG + Intergenic
1158401069 18:57121982-57122004 CTGTGGGTCTTTCACCCAGCTGG - Intergenic
1160415916 18:78710798-78710820 GGGTGTGCCCTGCCCCCAGGCGG + Intergenic
1160763480 19:797272-797294 CTCTGGGTCCCGCCCCCGGGCGG + Exonic
1161204500 19:3034042-3034064 CTGTGGGTCCAGCCACCAACTGG + Intronic
1161297361 19:3526675-3526697 GTGGGGGTCCTGCCCGTAGGGGG + Intronic
1161515299 19:4693066-4693088 GTGTGGGCTCTGCCCCCAGAGGG + Intronic
1161604402 19:5206688-5206710 CTGGGGGTCCAGGCCTCAGGAGG + Exonic
1161739483 19:6011851-6011873 ATGTGGCCCCTGCCCTCAGGGGG + Intronic
1161857328 19:6773298-6773320 CTGTGGTTCATGCCCCCAGATGG + Intronic
1163799475 19:19355956-19355978 CTGGGGGTCCTGCTGCGAGGTGG - Exonic
1164283361 19:23788774-23788796 CCCTGGGCCCTGCCCACAGGTGG + Intronic
1164314473 19:24074821-24074843 CTGTGAGCCCTACCCACAGGGGG + Intronic
1165735884 19:38175291-38175313 CTGTGGTCCCTGCCTCCAGGAGG - Intronic
1165744756 19:38224149-38224171 CCCCGGGTCCTGCCCCCAGCAGG + Exonic
1166054265 19:40279271-40279293 CAGTGGGTCCTGCCCCAAGGGGG + Intronic
1166543935 19:43623100-43623122 CTTTGGCCCCTGCCCCCTGGGGG + Exonic
1166677291 19:44747874-44747896 TTGGGGGCCCTGCCCCCAGCCGG - Intronic
1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG + Intronic
1166913294 19:46176665-46176687 ATGTGGGTGCTGCTCCTAGGGGG + Intergenic
1167016945 19:46847321-46847343 CTGGGAGGCCTGCACCCAGGAGG - Intronic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1168266900 19:55228277-55228299 CTGTGGGTCATGTCCCCAAGCGG - Exonic
1168271956 19:55254909-55254931 CCGTAGGTCCTGCCCAGAGGTGG - Intronic
925336535 2:3102738-3102760 CTTTGGGTCCTGCTCGGAGGAGG - Intergenic
925847166 2:8044432-8044454 CTGTGGGTCCTGCCCCATGGAGG + Intergenic
926121093 2:10241487-10241509 CTGTGAGCCCTGCCCCCGGTGGG - Intergenic
928137033 2:28695504-28695526 CTGTGGGCCCTGCCTGGAGGTGG - Intergenic
929127723 2:38536248-38536270 CTGGGGCTCCGGCCACCAGGTGG + Intergenic
929591958 2:43153373-43153395 CAATGGCCCCTGCCCCCAGGAGG - Intergenic
931637632 2:64355111-64355133 CTGTGGGACCAGCCCTCAGAAGG - Intergenic
932334953 2:70925230-70925252 CTGTGGGTCCCTTCCCCAAGTGG - Intronic
932618971 2:73254868-73254890 CTGTACCTCCAGCCCCCAGGGGG - Exonic
932708222 2:74043375-74043397 CTGTGCTTCCTGCCCACAGCTGG - Intronic
932773788 2:74515344-74515366 CTCTGGGTCCTGCCTCCGAGAGG + Intronic
934917263 2:98310299-98310321 GGGTGGGTTCTGACCCCAGGAGG + Intronic
935593395 2:104861870-104861892 GTGAGGATCCTGCACCCAGGAGG - Intergenic
936013578 2:108941568-108941590 CTGTTGGCCATGCCCCCAGCTGG - Intronic
936350092 2:111706086-111706108 ATGTGTGCCCTGCCCCCAGATGG + Intergenic
937223075 2:120353214-120353236 CTGTGGGGTCTGGCCCCCGGGGG + Intergenic
938342934 2:130547462-130547484 CTGTATGTCCAGCCACCAGGGGG - Intronic
938346899 2:130573260-130573282 CTGTATGTCCAGCCACCAGGGGG + Intronic
939795690 2:146641952-146641974 CAGTGGGTCCAGCCCACAGAGGG + Intergenic
941709137 2:168693418-168693440 CTCTGGGGCCTTTCCCCAGGTGG + Intronic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
943741800 2:191418144-191418166 CCGTGGGTCCCTTCCCCAGGTGG + Intronic
944200217 2:197098918-197098940 CCCTGGGTCCTGCCCCTCGGTGG + Intronic
944412832 2:199459240-199459262 CTGTGCGGCCTCCCCCCGGGCGG - Intronic
945896612 2:215489758-215489780 CTGTGGCTCCAGCCCCCATTGGG + Intergenic
946107887 2:217388038-217388060 CAGTTTGTCCTTCCCCCAGGTGG - Intronic
946245857 2:218387050-218387072 CTTAGGGTCCTGCTCCCAGGAGG + Intronic
946569657 2:221009915-221009937 TTAGTGGTCCTGCCCCCAGGAGG + Intergenic
948187307 2:236031641-236031663 TTGTGGGTTCTGCTCCCTGGGGG - Intronic
948363409 2:237438369-237438391 CTGTAGATCCTCCACCCAGGAGG + Intergenic
948379062 2:237540615-237540637 CTGTGGGTGCTGCCTCCCTGGGG - Intronic
948559220 2:238839609-238839631 TGCTGGGTCCTGCCTCCAGGAGG + Intergenic
948803669 2:240443911-240443933 GTGTGGGGCTTGGCCCCAGGCGG - Intronic
948893469 2:240917849-240917871 CTGTGTGTCCTGCCCACAGTCGG + Intergenic
1168960299 20:1864406-1864428 CTGTGGCTCCTGCTGCAAGGAGG + Intergenic
1169210739 20:3764995-3765017 ATGTGGGTCCTACCCTCAGTGGG - Intronic
1169357481 20:4919690-4919712 CTGGGGATCCTGTCCCCAGATGG + Intronic
1171342965 20:24444985-24445007 CTGAGACCCCTGCCCCCAGGGGG + Intergenic
1171438088 20:25139353-25139375 GTGTGGCTCCTGCCCCCAGGTGG - Intergenic
1172068724 20:32240463-32240485 CCCGGGGTGCTGCCCCCAGGTGG - Intergenic
1172162154 20:32876157-32876179 CTGTGGATTCTGGCCCCAGTCGG + Intronic
1172771593 20:37385424-37385446 CTTTGCTTCCTTCCCCCAGGTGG - Intronic
1173613187 20:44385816-44385838 CTGTTGGTCCTGGCACCTGGAGG + Intronic
1174367192 20:50063755-50063777 CTCTGGGTCAGGCCCCCCGGTGG + Intergenic
1174398841 20:50264926-50264948 CTGGGGATCCGGCCCCCAGGAGG - Intergenic
1175444947 20:59013505-59013527 CTGCAAGTCCTGCTCCCAGGTGG - Intergenic
1175575628 20:60058510-60058532 CTGTGGGCCCCTCTCCCAGGAGG + Intronic
1175596906 20:60242344-60242366 CTGTGGGTCCCACCCACAGATGG + Intergenic
1176304178 21:5114730-5114752 CTTTAGGTGCTGCCACCAGGGGG - Intergenic
1179852878 21:44147300-44147322 CTTTAGGTGCTGCCACCAGGGGG + Intergenic
1180669535 22:17542519-17542541 GAGAGGGTCCTGGCCCCAGGTGG - Exonic
1180848502 22:18997805-18997827 CTGTTGCTCCTGCCCCTGGGTGG - Intergenic
1181029846 22:20144407-20144429 GCGTGGGTCCTGGCCCCAGCAGG - Intronic
1181513425 22:23398912-23398934 GCGTGGGTCCTGGCCCCAGCAGG + Intergenic
1182478262 22:30588833-30588855 CTGTGGGCCCTGCCCTCTGGCGG - Intronic
1183252086 22:36737373-36737395 CAGTGTGTCCTGCTCCGAGGCGG + Intergenic
1183466460 22:37982731-37982753 CTGTGTGTCCTCTCCCTAGGAGG + Intronic
1183713403 22:39519965-39519987 CGCTGGCTCCTGCCCCCAGGCGG - Intronic
1184095577 22:42314574-42314596 CCGCAGGTCCTGCACCCAGGAGG + Intronic
1184342474 22:43893538-43893560 CTGGGGTACCTGCCACCAGGTGG - Intergenic
1185068495 22:48643762-48643784 TTTTGGGCCCTGCCCCAAGGAGG + Intronic
1185341533 22:50293385-50293407 CTGCGGGACCTGCCCCCGGGTGG - Intronic
1185418137 22:50721001-50721023 CGGTGGGGCCGGTCCCCAGGAGG - Intergenic
950027759 3:9832521-9832543 CTGTATGTCCTGCCCTCAGCTGG - Intronic
950266376 3:11576192-11576214 CTGGGGGTCATGGCCGCAGGTGG - Intronic
951347327 3:21561459-21561481 CAGTGGGTGCTGCCCACAGAGGG - Intronic
952953568 3:38543002-38543024 CTGAGGGCCCTGGCCCAAGGAGG + Intergenic
954839684 3:53499463-53499485 CAGAGTGTCCTGCCCCCTGGAGG + Intronic
955327413 3:58020004-58020026 CTGTGAGCCCTGCAGCCAGGGGG - Intronic
955539749 3:59961726-59961748 CAGTGGGTGCAGCCCACAGGGGG - Intronic
956164048 3:66383119-66383141 CTGAGCGTCCTGCCCGCAGCAGG - Exonic
958918271 3:100073784-100073806 CTGTGGGTCTTGTCTCCAGGAGG + Intronic
961638284 3:128348782-128348804 CACTGGGTCCTGTCCCCAGGAGG + Intronic
961812997 3:129532475-129532497 CTGCGGCTCCTGCTCCCTGGAGG + Intronic
964445509 3:156753310-156753332 ATGAGGGACCTGCCCCCATGAGG - Intergenic
966278453 3:178203413-178203435 CTGTTAGGCCTACCCCCAGGAGG - Intergenic
967824491 3:193867725-193867747 CTGTGGGTAATGCTCCCAGAGGG - Intergenic
968704735 4:2072635-2072657 CTCAGGGTCCTGCCCCCGGGAGG + Intronic
968809674 4:2794206-2794228 CTGTGGGCCCTGCCTTCAGGCGG - Intronic
968954636 4:3711987-3712009 CTGTGGGTCCTCGTCCCAGCTGG + Intergenic
969004542 4:4008734-4008756 ATGTGGGTGTTGCCCCCTGGAGG - Intergenic
969577266 4:8043716-8043738 CTGTTGTTCAAGCCCCCAGGAGG + Intronic
969977730 4:11121621-11121643 CTGTTGGTTCTACCCCCAAGAGG - Intergenic
970162523 4:13203588-13203610 CTATGGGCCCTGCCCCCAGGGGG + Intergenic
971004455 4:22357627-22357649 CAGTGGGTGCAGCCCACAGGGGG + Intronic
971555709 4:28011687-28011709 CTGTAGGCCTTCCCCCCAGGGGG + Intergenic
977199279 4:94096764-94096786 CTGTGGTCCCAGGCCCCAGGAGG - Intergenic
979392635 4:120144698-120144720 CTCTTGGTCCTGGCCCCAGCAGG + Intergenic
985577334 5:679424-679446 CCCAGGATCCTGCCCCCAGGCGG - Intronic
985834051 5:2257667-2257689 CTGTGGGACCTGCCCGGAAGGGG + Intergenic
986782920 5:11083845-11083867 CTGGGGTGCCTGCCCCCATGGGG - Intronic
986939973 5:12937619-12937641 CTGCAGGCCCTCCCCCCAGGGGG - Intergenic
987064036 5:14270271-14270293 TTCTGGGTCATGCCCCCTGGAGG - Intronic
990737402 5:58879174-58879196 CTGTGGCTTCTGCTCTCAGGAGG + Intergenic
990864901 5:60369400-60369422 CTGTGGGTTCTGAACCCATGGGG - Intronic
991026759 5:62037971-62037993 CTGTGGGTGCAGCCCACAGAGGG - Intergenic
993608924 5:90031291-90031313 CTGTGGGTGCAGCCCACAGAGGG + Intergenic
999102865 5:149041378-149041400 CTCTGGGACTTGCTCCCAGGAGG + Intronic
1001268764 5:170295107-170295129 CTGTGTGTCCTAATCCCAGGTGG - Intronic
1001308239 5:170591294-170591316 CTGTGGCCCCTGCCTCCATGTGG - Intronic
1001482051 5:172095405-172095427 CAGTGGGGCCTGGCTCCAGGAGG - Intronic
1002322620 5:178384688-178384710 CAGTGGGTGAGGCCCCCAGGAGG - Intronic
1003565681 6:7220101-7220123 CTGTGGGTCCTGCCTCCAGTGGG - Intronic
1003571727 6:7260651-7260673 ATGTGGGGGCTGCCTCCAGGAGG + Intergenic
1004125847 6:12872777-12872799 ATTTGGGTCCTGCCCCCTTGAGG - Intronic
1007708014 6:43803248-43803270 CTGTGCGTCCTGGGCCCAGCTGG - Intergenic
1009370250 6:62891237-62891259 ATGTGGGTAGTGCCCCCTGGTGG + Intergenic
1009598763 6:65771445-65771467 CTCTGGTTCCTGGCCCCCGGGGG + Intergenic
1012118958 6:95339821-95339843 CTCTGGGTGCTGCCCACTGGTGG - Intergenic
1014387151 6:120816504-120816526 CAGTGGGTGCTGCCCACAGGAGG - Intergenic
1014967718 6:127776488-127776510 ATCTGGGGCCTGCCCCAAGGCGG + Intronic
1016911263 6:149201363-149201385 CTGTGTGCCCAGTCCCCAGGGGG - Intergenic
1019385830 7:755607-755629 CTGTGGTTCCAGCTCCCGGGAGG + Intronic
1019577323 7:1743781-1743803 CTGGGGCTTCTGCTCCCAGGAGG - Intronic
1019614728 7:1954066-1954088 CTGTGGGTCCTGCCCCAGCTCGG + Intronic
1020013393 7:4818148-4818170 CTGTGGGGCCTTCTTCCAGGAGG + Intronic
1020997101 7:15278806-15278828 CTGAGAGTCCTGTCCCCAGAGGG - Intronic
1021329549 7:19318605-19318627 CTGTAGGTCTTGGCCCCATGTGG - Intergenic
1022102039 7:27174533-27174555 CTGTGGGGGCTGCCCCAACGTGG + Intronic
1022564672 7:31385835-31385857 CTCTGGGTCCTGCTCACAGCAGG + Intergenic
1022658857 7:32347429-32347451 CTGTGGATCCTGCCCCCTGGTGG + Intergenic
1023841913 7:44102964-44102986 CTTGTGGTCCTGCTCCCAGGGGG + Intergenic
1025023364 7:55497031-55497053 CTGAGGCTCCCGCCCACAGGAGG + Intronic
1025178030 7:56811700-56811722 CTGCGGGGGCTGCCCCAAGGCGG + Intergenic
1025691680 7:63756184-63756206 CTGCGGGAGCTGCCCCAAGGCGG - Intergenic
1025739465 7:64183681-64183703 CGGAGGGCCCTGTCCCCAGGAGG + Intronic
1026658259 7:72276169-72276191 CAGTGGGTCCTGCACGCATGGGG + Intronic
1029130401 7:98325970-98325992 GTGTTGGTACTGACCCCAGGAGG - Intronic
1029390131 7:100269517-100269539 CTGTAATACCTGCCCCCAGGTGG - Intronic
1032419044 7:131762939-131762961 CTGTGGCTCCAGCCATCAGGAGG - Intergenic
1032805339 7:135348649-135348671 TTGTGGGTACTGCTCCCAGGAGG + Intergenic
1033151498 7:138918699-138918721 CTGTGAGACCTCCCCCAAGGAGG + Exonic
1034763532 7:153696151-153696173 CTGCGGGCCCAGGCCCCAGGTGG - Intergenic
1035315232 7:157993470-157993492 CTGTGGTTCCTGGCCCTGGGTGG - Intronic
1035320274 7:158024623-158024645 ATGTGGCTCCTGACCCCATGGGG + Intronic
1035555109 8:562242-562264 CTTAGGGCCCTGCCCCCAGACGG - Intergenic
1036795154 8:11750239-11750261 ACGTGGGTCCTGCGCCCATGCGG + Intronic
1037649752 8:20825570-20825592 CTGTGGCTTCTGCCTCCATGGGG + Intergenic
1037722300 8:21455279-21455301 TTGTGGGTTCAGCCCTCAGGGGG - Intergenic
1037885041 8:22591532-22591554 CTGTCTGCCCTGCCCCCAGGTGG + Exonic
1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG + Exonic
1039557942 8:38490191-38490213 CACTGCGTCCTGTCCCCAGGTGG + Intergenic
1039913301 8:41841846-41841868 CTCAGGGTCCTGGCCACAGGTGG - Intronic
1040469986 8:47728945-47728967 CTGTGGGGACTGCTCCCGGGTGG + Exonic
1041349839 8:56937419-56937441 CAGTGGGTGCAGCCCACAGGGGG + Intergenic
1045322630 8:101093441-101093463 CTGTGGGTTCCTCCTCCAGGGGG - Intergenic
1048981041 8:139703509-139703531 CTGTGGGTCCAGCTCGCGGGTGG + Intergenic
1049513629 8:143042461-143042483 CTGTGGGTTCTGGTCCCTGGGGG + Intronic
1049564325 8:143330404-143330426 CTGTGGGGGCTGCCCACGGGAGG - Intronic
1049742970 8:144249824-144249846 GTGTGGGTCCTGCCTCCGGTGGG + Intronic
1051921153 9:22266984-22267006 CTGTGGGTCCTGCTTCAAGATGG + Intergenic
1053028997 9:34758350-34758372 CTGTGTGTCCTGCCCCAAGCAGG - Intergenic
1054970494 9:71080293-71080315 CTATGGGTCCTGCCACCATTAGG - Intronic
1055568609 9:77593635-77593657 CTGGCTGCCCTGCCCCCAGGAGG - Intronic
1057299569 9:93870080-93870102 CTGGGGAGCCCGCCCCCAGGTGG + Intergenic
1058896691 9:109406432-109406454 CTATGGCTCCTCCCCCCAGGTGG + Intronic
1059325640 9:113502543-113502565 CTGTGTTTCCTGCCCTCATGGGG + Intronic
1059392722 9:114009056-114009078 GTGTGGCTCCTGCCCTCAAGGGG - Intronic
1059489947 9:114658757-114658779 CTGTGGGACCTGGGCCCAGCTGG - Intergenic
1060028859 9:120197054-120197076 CTGTAGGTCCTACAACCAGGAGG + Intergenic
1060114906 9:120932229-120932251 TTGTGGCTCCTGCAGCCAGGGGG + Intergenic
1061685027 9:132268917-132268939 TTTTGGTTCCTGCCACCAGGTGG - Intronic
1061862164 9:133473619-133473641 CAGAGGGTCCTGGCCCCACGAGG - Intronic
1062075926 9:134589960-134589982 CTGGTGCCCCTGCCCCCAGGAGG - Intergenic
1062249771 9:135588270-135588292 CTGTGGGTTCAGGGCCCAGGTGG - Intergenic
1062267339 9:135693230-135693252 CTGTGGGACCTGCTCCCTGGAGG - Intergenic
1062426044 9:136506695-136506717 CGGTGGGTGCCGCGCCCAGGCGG - Exonic
1062460545 9:136660946-136660968 TTGTGGGTCCTTCCACCAGGAGG + Intronic
1062525652 9:136977140-136977162 ATGTGGGTCCTGGCCCCCAGTGG + Intergenic
1062599220 9:137312489-137312511 CTGGTGGCCCGGCCCCCAGGAGG - Intronic
1190063319 X:47224334-47224356 CTGTGGTTCCTGACCCCACCTGG + Intronic
1190683456 X:52849549-52849571 CTGTGGGTGCAGCCCACAGAGGG - Intergenic
1191096038 X:56673823-56673845 CTGTGGGTTCAGCCCACAGAGGG + Intergenic
1191174248 X:57482553-57482575 CAGTGGGTCCAACCCACAGGAGG - Intronic
1193507466 X:82362138-82362160 CTGTAGGCCCTCCCCACAGGAGG + Intergenic
1194302476 X:92204862-92204884 CTTTGTCTCCTGCCACCAGGTGG - Intronic
1196016313 X:110944236-110944258 TTGTGGTTCCTGCAGCCAGGCGG - Intergenic
1197772608 X:130098830-130098852 CTGTAGGGCCTGCCTGCAGGTGG - Intronic
1199198520 X:145060002-145060024 ATGTGGGTACAGCCCCCAGGTGG + Intergenic
1201863465 Y:18624750-18624772 CTGTTGGTCCATCCACCAGGAGG + Intergenic
1201869857 Y:18695628-18695650 CTGTTGGTCCATCCACCAGGAGG - Intergenic
1202047638 Y:20750527-20750549 CTGTGGGACTAGCCCCCAGAAGG - Intergenic
1202584410 Y:26408695-26408717 CTGTGCTGCCTGCCCCCGGGGGG - Intergenic