ID: 1038319892

View in Genome Browser
Species Human (GRCh38)
Location 8:26516146-26516168
Sequence CCTTATATGAATAAATTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038319892 Original CRISPR CCTTATATGAATAAATTAGA GGG (reversed) Intronic
906071095 1:43016979-43017001 CCTTATAAGAGCAAATCAGAGGG + Intergenic
906623325 1:47303580-47303602 ACTTAAATGAATAGGTTAGATGG + Intronic
906634501 1:47399792-47399814 CCTAACCTGAATGAATTAGAAGG - Intergenic
907652176 1:56305641-56305663 GCTTATATTATTTAATTAGATGG - Intergenic
907959937 1:59269383-59269405 TCTTATAGGATTAAATTAGAGGG - Intergenic
910849067 1:91633623-91633645 CCTTATATGGCTAAAGTAGAGGG + Intergenic
911216101 1:95197151-95197173 CCTTATGGAAATAAATTAGAAGG - Exonic
911444971 1:97981310-97981332 ACTTTTATGAATATATTACAAGG - Intergenic
912060407 1:105661157-105661179 CCTTATATAAACAAAATAGTGGG + Intergenic
913609474 1:120496178-120496200 CCTGATTTGAATAAAATTGAAGG + Intergenic
913985985 1:143566510-143566532 CCTGATTTGAATAAAATTGAAGG - Intergenic
914204349 1:145514338-145514360 CCTGATTTGAATAAAATTGAAGG - Intergenic
914483471 1:148087526-148087548 CCTGATTTGAATAAAATTGAAGG - Intergenic
914581716 1:149025661-149025683 CCTGATTTGAATAAAATTGAAGG - Intronic
915021306 1:152782118-152782140 TCTGATATGAATAAACTGGATGG + Intronic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
916142035 1:161708324-161708346 GCTTCTATGAACAATTTAGAAGG - Intronic
917338329 1:173948254-173948276 CCTTATAGGACTAAAGCAGAAGG - Intronic
918062026 1:181070226-181070248 CAATATATGAATAAATTCCATGG - Intergenic
918391704 1:184071091-184071113 TATTATATGAATCAATTAAATGG - Intronic
919382033 1:196871616-196871638 TCATATATGAACAAATTAAATGG - Intronic
919388564 1:196953200-196953222 CCTTATATGAATAAAGCAGCTGG + Intronic
919391038 1:196986313-196986335 CCATATATGAATAAAGCAGCTGG + Intronic
919673437 1:200358396-200358418 CTTTAAATGGATAAATTATATGG - Intergenic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
921795609 1:219340529-219340551 CCTATTATGAATAAGTAAGAAGG - Intergenic
922369932 1:224899564-224899586 CTTTAAATGAATACATTATATGG + Intronic
923977480 1:239280127-239280149 CTTTATATGAACTAATGAGATGG + Intergenic
1063836358 10:10018765-10018787 CTTTAAATGAGTAAATTATATGG + Intergenic
1064621390 10:17221334-17221356 CCTTAAAGGAATAAAGTAGATGG - Intergenic
1065037989 10:21660123-21660145 AATTATAAGAAAAAATTAGATGG - Intronic
1066130953 10:32393587-32393609 ACTTTTAAGAATAAATTAGAGGG - Intergenic
1066247159 10:33594544-33594566 ACTTTTATGAATAAAGTAAATGG - Intergenic
1067678912 10:48413927-48413949 CGTTAAATGAATAAATTGTATGG - Intronic
1067808281 10:49408142-49408164 CCTTTATTGAATAAATTAGTGGG + Intergenic
1071097920 10:82000672-82000694 CATTTTGTGAATAAATTAGGAGG - Intronic
1071209794 10:83326954-83326976 TTTTATGTCAATAAATTAGATGG - Intergenic
1072282578 10:93881152-93881174 CCTTATGTGAGGAATTTAGAAGG - Intergenic
1072426049 10:95331745-95331767 CCTTATCTGAGGAATTTAGAAGG + Intronic
1073885660 10:108036880-108036902 CCTTATATGAATAAGGCAGAGGG - Intergenic
1074497085 10:113988923-113988945 CCTTCTATGAATATATCAGATGG - Intergenic
1074871627 10:117581451-117581473 ACATATATAAATAAATGAGAGGG + Intergenic
1078680222 11:13468940-13468962 CCTTATCTGAGGAATTTAGAAGG + Intergenic
1079793762 11:24772606-24772628 CCTTATATGGATAGTTTATAGGG - Intronic
1080510812 11:32969060-32969082 CCTCATATGAAAAAAATAGATGG + Exonic
1087713181 11:101578028-101578050 CCTTATTTGAATAAATATCAAGG + Intronic
1087892058 11:103546700-103546722 CCTAATCTGTACAAATTAGAGGG - Intergenic
1088335786 11:108702078-108702100 CCTTATCTTATTAAATTTGAGGG - Intronic
1088408636 11:109508985-109509007 CCTTAAAAGAATAAATTAAGTGG - Intergenic
1089275009 11:117328737-117328759 TATTAGATGAATAAATTAAAGGG - Intronic
1089890804 11:121878914-121878936 CCTTATCTGAGGAATTTAGAAGG - Intergenic
1089989539 11:122846087-122846109 CCTTGTGTAAATAAATGAGATGG + Intronic
1090564035 11:127966543-127966565 ATTTATATGGACAAATTAGATGG - Intergenic
1090753646 11:129769703-129769725 ACATATATAAATACATTAGAGGG + Intergenic
1091964058 12:4723185-4723207 CCATAGATGAATAAATGAGTGGG + Intronic
1092053640 12:5491178-5491200 CCTTATATGTATAAATGAGGAGG + Intronic
1092805745 12:12220531-12220553 CCATTTATGATTAAAGTAGAGGG + Intronic
1092850685 12:12623858-12623880 CCTTATAAGACTAAGGTAGAGGG + Intronic
1092883706 12:12907791-12907813 CTTTATATTAAAAAATTAGCTGG - Intronic
1093912827 12:24766652-24766674 CTTTCAATGAATAAATTACAAGG + Intergenic
1094737838 12:33255172-33255194 CCTTATCTGAAGAATTTAGAAGG - Intergenic
1095329904 12:40947494-40947516 CATTAAATGAATAAATAAAATGG - Intronic
1095641756 12:44493946-44493968 CCTGATATAAATAAATTTGTGGG - Intergenic
1096259161 12:50080339-50080361 CCTTTTAGGATTAAATGAGATGG - Intronic
1098630366 12:72714625-72714647 TCTTATAGGAATAAATTGTAAGG - Intergenic
1099079843 12:78163381-78163403 ACATGTATGAATAACTTAGAAGG + Intronic
1100427255 12:94498897-94498919 CCTTATCTGAGGAATTTAGAAGG + Intergenic
1102521606 12:113480641-113480663 CTTTATCAGAATAAATCAGAGGG - Intergenic
1102643454 12:114387254-114387276 CTTCAAATGAAGAAATTAGAGGG - Intronic
1103115279 12:118323667-118323689 CCTTATATAAATATATTAAGTGG + Intronic
1103229736 12:119319252-119319274 AGTTATAAAAATAAATTAGAAGG + Intergenic
1105840324 13:24248465-24248487 AATTATCTGAAAAAATTAGAAGG + Intronic
1106317301 13:28605949-28605971 CTTTATATGAGTGAATTATATGG + Intergenic
1107181636 13:37467978-37468000 CCTTAAATGAAAAACTTAGAAGG + Intergenic
1107199801 13:37700736-37700758 ATTTATATGTATAAATTAGATGG - Intronic
1109636572 13:65125827-65125849 CTTTACATGGATAAAATAGAAGG + Intergenic
1111737655 13:92163157-92163179 ACTGATAAGAATAAATTTGATGG + Intronic
1113089760 13:106604712-106604734 ACTTATATTAATAAATAAAAAGG - Intergenic
1113435246 13:110286288-110286310 CCTCATGTGAATAAACCAGATGG - Intronic
1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG + Intergenic
1116605496 14:46988121-46988143 CCATATATGAATGTATGAGAAGG + Intronic
1117405631 14:55400468-55400490 GTTTATATAAATAAATTATATGG - Intronic
1117798600 14:59420133-59420155 TTTTAAATGAGTAAATTAGATGG - Intergenic
1118260040 14:64238006-64238028 CTTAATATGGATAAATTATATGG + Intronic
1120123817 14:80716232-80716254 CTTTAAATGGATAAATTATATGG - Intronic
1120391411 14:83913071-83913093 CCTTATGGGAATAAAATGGAGGG - Intergenic
1120466323 14:84862313-84862335 CCTTAAAACAATGAATTAGAAGG + Intergenic
1120561092 14:85993664-85993686 CCTTATGTGAATCAATGTGATGG + Intergenic
1120642801 14:87035836-87035858 TGTTATATTAATAAAATAGATGG - Intergenic
1120646183 14:87077251-87077273 CCTTGTATGAATCCACTAGATGG - Intergenic
1125908977 15:43419325-43419347 CCTTATATGATAACATGAGAAGG + Intronic
1126431247 15:48587340-48587362 CTTTGTATGTATAAATTAGTGGG - Intronic
1126460104 15:48905890-48905912 ATTTATATGGATAAATTAGCAGG + Intronic
1127513478 15:59667613-59667635 CCTTTTATGCTTAAATTAAATGG - Intronic
1128040765 15:64571367-64571389 TATTATATGAATAGATTAAATGG + Intronic
1129925902 15:79364315-79364337 CCTTATATGCATAAAATATCTGG + Intronic
1133450338 16:5898744-5898766 TTTTATATGAATTAATGAGAGGG - Intergenic
1135874851 16:26189061-26189083 GCCTAGATGAACAAATTAGAAGG + Intergenic
1137860833 16:51845234-51845256 GCGTATAGGAAAAAATTAGAAGG + Intergenic
1138765899 16:59603036-59603058 CATTGTATGAATAAATTACAAGG - Intergenic
1138935393 16:61714539-61714561 CCTGAGATGAATAAATTATAGGG + Intronic
1140136612 16:72211346-72211368 TCTTCTCTGAATAAACTAGATGG + Intergenic
1141453973 16:84126131-84126153 CATTATAGGAATAAATCAGTTGG + Intronic
1142525648 17:538409-538431 CCTTCTATGAACATATTATATGG - Intronic
1143673677 17:8414686-8414708 CCTCAAATAAATAAATAAGATGG - Intronic
1144003383 17:11076333-11076355 CCTTATAAGAAGAAAATATATGG - Intergenic
1144335699 17:14267302-14267324 CCTTATATGAGAAAGGTAGAGGG - Intergenic
1147815040 17:43203566-43203588 CCTTAAGAGAAAAAATTAGATGG - Intronic
1148525342 17:48327546-48327568 ACTTAAATGGATAAATTATAAGG - Intronic
1148916457 17:50984134-50984156 CCTTAAATGAATTAAGTTGAGGG - Intronic
1151081234 17:71331917-71331939 ACTTATAGCAATAAAATAGAAGG + Intergenic
1153169656 18:2301310-2301332 CCTTATATTAATAATTCTGAAGG - Intergenic
1155813148 18:30264737-30264759 ACTTACATAAATAAGTTAGATGG + Intergenic
1156109751 18:33711635-33711657 TATCATTTGAATAAATTAGATGG + Intronic
1158958571 18:62566896-62566918 CCTTGTTCTAATAAATTAGAGGG + Intronic
1159303030 18:66601199-66601221 CTTTTTAGGAATAAAATAGATGG + Intronic
1159733800 18:72067383-72067405 CCTTACAGGAATAAATAAAATGG + Intergenic
1164788662 19:30957871-30957893 CAATTTATGAATAAATGAGAGGG + Intergenic
1168130529 19:54315506-54315528 CATTTTATTAGTAAATTAGAGGG + Intergenic
927480578 2:23450759-23450781 CCTTAAATGGGTAAATTATAGGG - Intronic
928069223 2:28198034-28198056 CCATGTAAGGATAAATTAGAAGG + Intronic
929117204 2:38454481-38454503 CTTTAAATGGATAAATTATATGG - Intergenic
931163519 2:59719967-59719989 CTTTATTTGAATGAATGAGAGGG - Intergenic
931511648 2:63002831-63002853 CATTCCATGAATAAAGTAGATGG + Intronic
931685340 2:64787482-64787504 CCTTATAAGACTAAAGTGGAGGG + Intergenic
932141024 2:69278210-69278232 CCTTAAATGAATAAATTGTATGG + Intergenic
933284477 2:80370381-80370403 ATTTATATGAATAAAGTAAAAGG - Intronic
935660447 2:105462234-105462256 CCTTATAGGATTAAAACAGAGGG - Intergenic
935935227 2:108175204-108175226 CTTCCTATGAATAAAATAGATGG + Intergenic
936579806 2:113688621-113688643 CTTTAAATGCTTAAATTAGAAGG + Intergenic
938835650 2:135101184-135101206 AATTATATGAATAAAACAGAAGG - Intronic
939235699 2:139489631-139489653 CCTTATATAAATTTATTGGAAGG + Intergenic
939468404 2:142587593-142587615 CCTTATATGATTAAGTTATGAGG - Intergenic
939673054 2:145037540-145037562 CAGTATATGAATGAATTATAAGG - Intergenic
941199186 2:162488426-162488448 CCTTATCTGAGGAATTTAGAAGG + Intronic
941414515 2:165203150-165203172 CTTTAAATCAATAAATTAAAAGG + Intronic
941993189 2:171576811-171576833 CCTTATCTGAGGAACTTAGAAGG - Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943635649 2:190303880-190303902 CCTGATATGATGAGATTAGAAGG + Intronic
944997043 2:205305163-205305185 CCTTATAGGGTTAAAGTAGAGGG + Intronic
945763258 2:213941742-213941764 CAGTATATGAATAAAATGGAAGG - Intronic
945765938 2:213977727-213977749 CCTTAAATCTATAAATAAGAAGG - Intronic
947029716 2:225780188-225780210 CCTTATAAGAAAAAGTCAGAAGG - Intergenic
947081018 2:226397163-226397185 TCTTGAATGAATAAATTAGGAGG + Intergenic
1170037843 20:12008352-12008374 CCATATTTCAACAAATTAGAGGG + Intergenic
1170659871 20:18327131-18327153 CCTAATATCAAAAAATTAAAAGG - Intergenic
1172792265 20:37513960-37513982 CCTCAAATGAATGAATGAGAGGG + Intronic
1172824870 20:37772913-37772935 CCTCATAAGAATAAATTAGTGGG - Intronic
1173746793 20:45443746-45443768 CCTTCTAAGAATTAATCAGAAGG + Intergenic
1173884922 20:46449046-46449068 CCTGATATGAAGTGATTAGAAGG - Intergenic
1178325201 21:31639746-31639768 CCTTATATGAATCTGTGAGAAGG - Intergenic
1178385372 21:32144657-32144679 CCTAATAATAATAAATTAAAGGG - Intergenic
1179398020 21:41059158-41059180 CCTTATAGGAAGAAAGTAGGAGG - Intergenic
1183682359 22:39340155-39340177 TATCATATGAATAGATTAGAAGG - Intergenic
949316246 3:2758853-2758875 CCTTAAATGAATGAATTGTATGG - Intronic
949610448 3:5698584-5698606 CCTAATATTAAAATATTAGAAGG - Intergenic
950284073 3:11731277-11731299 CCTTATATATGTAATTTAGAAGG - Intergenic
950605666 3:14077504-14077526 CCTTTTATGAATCATTTAGGAGG + Intronic
951362090 3:21737434-21737456 CATTATATGTATAAACAAGAGGG + Intronic
951622492 3:24619382-24619404 ACTTATATTATTAAATTTGAGGG - Intergenic
954522813 3:51244320-51244342 TCTTATATTCATTAATTAGAAGG - Intronic
954669635 3:52282644-52282666 CCTTATCTGAGGAATTTAGAAGG - Intronic
955432352 3:58860493-58860515 CCAAATATGAATAAATTCGGGGG + Intronic
955466402 3:59242130-59242152 GCTTAAAAGAATAAACTAGAAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957378067 3:79386263-79386285 ACTTATATAAATAGATTAGTAGG - Intronic
957580335 3:82064470-82064492 GCTCATAGGAATAAAATAGAGGG + Intergenic
958513970 3:95088544-95088566 CCTTATTTAAATAACTTAGTGGG - Intergenic
959570149 3:107874342-107874364 CCTGATATGGATAAATTTAAAGG + Intergenic
960473961 3:118101176-118101198 CCTTATAGGGATAAAGCAGAGGG + Intergenic
963962156 3:151321901-151321923 CCTTATAGAAAAAAATAAGATGG - Intronic
964703334 3:159592697-159592719 TGTTATATGAACAAAGTAGAGGG - Intronic
964843509 3:161020876-161020898 CTTTATATCAATAAAATAAAAGG - Intronic
965053163 3:163678146-163678168 CTTTATAGGGTTAAATTAGAAGG + Intergenic
965424981 3:168511458-168511480 CTTTATATGAAGAAAAGAGAAGG + Intergenic
965891291 3:173517229-173517251 CCTTAAATGAAGTAATGAGAAGG + Intronic
966610291 3:181861375-181861397 CATTGAATGAATAAATGAGAAGG - Intergenic
966756689 3:183377992-183378014 CCTTCTCTGAAGAAATAAGATGG + Intronic
968259111 3:197305021-197305043 CCTTTTATAAATAAATTGGGCGG + Intergenic
970626080 4:17884517-17884539 CCTTATATGAATAACTATCATGG + Exonic
970731994 4:19116274-19116296 AATTAGGTGAATAAATTAGAGGG - Intergenic
971588571 4:28436911-28436933 CCTTATCTGAGGAATTTAGAAGG + Intergenic
971718783 4:30216823-30216845 CCTTATAGGTGAAAATTAGATGG + Intergenic
971894258 4:32570780-32570802 CCTTATAAGAATGCATCAGATGG + Intergenic
971902632 4:32681869-32681891 CATTATCTAAATAAATTATAGGG - Intergenic
971977250 4:33706699-33706721 ACTTATAAAAATACATTAGAAGG - Intergenic
972051870 4:34745205-34745227 CTTTAAATGAATGAATTATATGG + Intergenic
972053904 4:34775322-34775344 CCTTATCTGAGAAATTTAGAAGG - Intergenic
972362587 4:38341936-38341958 AGTTATGTGAATATATTAGATGG + Intergenic
974075205 4:57162461-57162483 CTTTAAATGAAAAAATTACATGG - Intergenic
974222899 4:58999438-58999460 CCTTATAAGGTTAAAGTAGAGGG - Intergenic
974364749 4:60932197-60932219 CCTTAGATTAATAAGATAGATGG - Intergenic
974731017 4:65866348-65866370 CCTTATTTTTATTAATTAGATGG - Intergenic
975178944 4:71321190-71321212 AGTGATATGAATAATTTAGAAGG + Intronic
977207837 4:94183336-94183358 CCTTAAATGTGTAAATTATATGG + Intergenic
977293138 4:95184636-95184658 CCTTACATTGAAAAATTAGAGGG - Intronic
977566199 4:98583247-98583269 CTTTATATCAATAAATAAGTGGG - Intronic
978056296 4:104272293-104272315 AATTATATGAATATATTTGATGG + Intergenic
978701066 4:111646901-111646923 ACTTATATGAATACATTAGCAGG - Intergenic
979194921 4:117909364-117909386 GGTTACATGGATAAATTAGATGG + Intergenic
980345194 4:131606531-131606553 CCTTATTTAAAAAAATTAGCTGG + Intergenic
980727517 4:136784197-136784219 TCATATAAAAATAAATTAGAGGG + Intergenic
981959238 4:150515279-150515301 CCTTATATCAACAAATTAAAAGG + Intronic
982061392 4:151607534-151607556 CATTAATTGAATATATTAGATGG - Intronic
984119261 4:175722325-175722347 CCTTATCTGAGGAATTTAGAAGG + Intronic
984176279 4:176421943-176421965 CATAAGATGAAAAAATTAGAGGG + Intergenic
984554430 4:181197212-181197234 ACAGATATCAATAAATTAGAAGG - Intergenic
987405027 5:17516301-17516323 TCTTAAATGAAAAGATTAGAAGG - Intergenic
987412624 5:17630033-17630055 TCTTAAATGAAAAGATTAGAAGG - Intergenic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
988237868 5:28570246-28570268 CATTAAATGAATAAATAAGTAGG + Intergenic
988635404 5:32978199-32978221 CGTTATATGAACAAATTGAAGGG - Intergenic
989712356 5:44414789-44414811 CATAAAATGAATAAATAAGATGG + Intergenic
990009170 5:50975217-50975239 CCTTGGATGTATAAATTACAGGG - Intergenic
990063692 5:51684785-51684807 CTTTATATCAATAAATTAAAAGG + Intergenic
990804992 5:59650213-59650235 ACTAAGATGAATAAATTAGAGGG + Intronic
991178167 5:63715448-63715470 CCTGATATCAATAAATTTGTAGG - Intergenic
993588764 5:89767123-89767145 CCCTATATGAAGAAAATATAAGG - Intergenic
994335179 5:98556485-98556507 CCTTTTAAGAATAAAATACAAGG - Intergenic
994386638 5:99141403-99141425 ACTAATATGCACAAATTAGATGG - Intergenic
994573385 5:101542632-101542654 CTTTAAATGAATAACTTACATGG + Intergenic
994960803 5:106599840-106599862 TCTTATATGAATAAACTCTAAGG + Intergenic
995337891 5:111023401-111023423 TCTTGAATGAATAAATTAGTGGG - Intergenic
996331488 5:122334460-122334482 CATTATATGAAAAAATAAGCTGG + Intronic
996811961 5:127525707-127525729 CCTTATTTTAATAATTTAAATGG - Intronic
996999087 5:129737423-129737445 TTTTATATGAATGAATTAGTTGG + Exonic
997048251 5:130346342-130346364 CATTATATGAATGAATAAAAAGG - Intergenic
997930300 5:138067242-138067264 TCTTATATGAGCAATTTAGAAGG + Intergenic
998889973 5:146735552-146735574 TTTTATATGATTAAATTGGATGG + Intronic
1001899358 5:175411934-175411956 ACTTATATTAATAAGTGAGAAGG - Intergenic
1003754617 6:9102845-9102867 CCTTATATGATGCAATGAGAGGG - Intergenic
1004115776 6:12766273-12766295 CCTTCTATGAATTAATTGTAAGG - Intronic
1005125937 6:22446961-22446983 CCTTATCTGTTTAAATCAGAAGG + Intergenic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1005264996 6:24102393-24102415 CCTTATCTGAGGAATTTAGAAGG - Intergenic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1008324218 6:50157665-50157687 TCTTATATTAATATTTTAGAGGG - Intergenic
1008783128 6:55131556-55131578 TGTTATATGAATAAACTTGATGG - Intronic
1009900187 6:69800276-69800298 CCTTATATGCATAATTAAAAAGG - Intergenic
1009920181 6:70048768-70048790 CCTTATATTGATATATTAAATGG - Intronic
1009920232 6:70049915-70049937 CCTTATATTGATATATTAAATGG + Intronic
1009920836 6:70058697-70058719 GTTTATGTTAATAAATTAGAGGG - Intronic
1010361641 6:75001894-75001916 CTTTGTATTAATACATTAGAAGG - Intergenic
1010505013 6:76646299-76646321 CCTTATATTAATAGTTTAGGAGG + Intergenic
1010686916 6:78864082-78864104 ACTGATAAGAATAAATGAGAAGG - Intergenic
1010978585 6:82343784-82343806 CTTTAAATGAATGAATTATATGG - Intergenic
1011082640 6:83506579-83506601 GATTATATGAATAAAGGAGAAGG - Intergenic
1012670460 6:102039097-102039119 CCCTAAATGAATCAATTAGAAGG - Intronic
1014577260 6:123089018-123089040 CCTTATAAGAAGAACTTATAAGG - Intergenic
1015002643 6:128237881-128237903 CTATATATCAATCAATTAGAAGG - Intronic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1016424458 6:143919365-143919387 ACATATATGAGGAAATTAGAAGG - Intronic
1016571179 6:145514826-145514848 CCTAATATAAAGAAATTTGAAGG + Intronic
1016807766 6:148229626-148229648 CTTTCAATGAATAAATTATAAGG - Intergenic
1017472034 6:154748294-154748316 GCTTTAATGAATAAATGAGAAGG + Intronic
1020052007 7:5087895-5087917 CCTTATATTAATAAAAGGGATGG - Intergenic
1020987228 7:15151246-15151268 CTTTGAATGAATAAATAAGATGG - Intergenic
1021415913 7:20384346-20384368 CTTTATATGTCTAAATTACATGG + Intronic
1021432882 7:20581609-20581631 ACTTAAATGAATATATTATAAGG + Intergenic
1022194147 7:28047860-28047882 ACTTATATTGATAAATTAGATGG + Intronic
1022785033 7:33630242-33630264 CCATATATGTGTAAATTAAATGG - Intergenic
1024436293 7:49359376-49359398 TCTTTAATGAATAAATTAAAAGG - Intergenic
1024468056 7:49734856-49734878 CCTTAGATGAAGAATTTAGCTGG + Intergenic
1026357557 7:69572330-69572352 CTTTATATGAAGAAATTATTTGG + Intergenic
1027387094 7:77669570-77669592 CCTTATATCAATAACATGGAGGG - Intergenic
1027502017 7:78964103-78964125 CCTTTTATAAATGTATTAGAAGG - Intronic
1027716470 7:81677296-81677318 CCTTTTTAGAATAAATTAGCTGG + Intergenic
1028255249 7:88587766-88587788 CCTTTTTTAAATAAATGAGAAGG + Intergenic
1030066505 7:105663518-105663540 CTTTAAATACATAAATTAGATGG + Intronic
1030556676 7:111033465-111033487 ACTTATTTGAATAAATAACAAGG - Intronic
1031678142 7:124636287-124636309 CCTTAAAAGAAGAAATTATATGG - Intergenic
1031769304 7:125822973-125822995 CCAAAAATGAATAGATTAGATGG - Intergenic
1032181073 7:129678629-129678651 CCTTAGAAGAATATAGTAGAAGG + Intronic
1032620069 7:133520647-133520669 GTTTATATGAATCAATTACAGGG + Intronic
1033266761 7:139893824-139893846 TATTAACTGAATAAATTAGATGG + Intronic
1033988808 7:147258975-147258997 TCCTATATGAATAAAGCAGATGG + Intronic
1036062807 8:5343236-5343258 CCTTACATGAATATGTTAAAAGG - Intergenic
1036070266 8:5434697-5434719 CCTGAGATGAAGGAATTAGAGGG - Intergenic
1037143362 8:15543767-15543789 CTTTATAATAATAAATTATATGG + Intronic
1037226285 8:16595255-16595277 CATTTTATGAATAGCTTAGAGGG - Intergenic
1038319892 8:26516146-26516168 CCTTATATGAATAAATTAGAGGG - Intronic
1038470770 8:27816843-27816865 CCATATATCCATAAATTATACGG - Intronic
1038593368 8:28861908-28861930 CCTTATTTGTATAGATGAGAAGG + Intronic
1039409713 8:37342490-37342512 CCTGAAATGAATAAAATAGAAGG - Intergenic
1040040794 8:42915133-42915155 CCTTATCTGAGGAATTTAGAAGG - Intronic
1043360894 8:79470759-79470781 CCTTATATGGTTAAAACAGAGGG - Intergenic
1044049920 8:87487832-87487854 ATTTATATAAATAAATTAGTAGG - Intronic
1044489901 8:92801020-92801042 CCATATATTAATAAATAAGCTGG + Intergenic
1044503225 8:92986999-92987021 CCTAATAGGAATAAATGAAATGG + Intronic
1045710628 8:104979346-104979368 CCTTATAAAAAGAAACTAGAGGG - Intronic
1045848827 8:106669232-106669254 CCTAAAATGAATAAATTAAATGG - Intronic
1045991484 8:108314047-108314069 ATTTATATATATAAATTAGAAGG + Intronic
1046541972 8:115596921-115596943 TCTTATAAGAATAATTTTGACGG - Intronic
1047449243 8:124948958-124948980 CCTTATATTAATTATTTTGATGG - Intergenic
1049096414 8:140550926-140550948 CCATATTTGTGTAAATTAGAAGG - Intronic
1050270203 9:3935889-3935911 CCTAATATGCATAAATGCGATGG - Intronic
1050800426 9:9605381-9605403 CCTTAAATGAAGAAATAAGTAGG + Intronic
1050984186 9:12061105-12061127 CCTTATAAGAAAAAAGCAGAAGG - Intergenic
1050990528 9:12145752-12145774 CCTTATCTGAGGAATTTAGAAGG + Intergenic
1051505112 9:17818380-17818402 CTTTATAGGAATAAATTATGTGG + Intergenic
1052447424 9:28581181-28581203 ACTTCTAGGAATATATTAGATGG - Intronic
1052520234 9:29537913-29537935 CCTTATAGGAATAGTTTAGTTGG + Intergenic
1052895147 9:33740728-33740750 ACATATATAAATATATTAGAGGG + Intergenic
1056288157 9:85112351-85112373 CCTCATATGAAAAAAATAAAAGG + Intergenic
1056374391 9:85992351-85992373 CCTGATATAAATAAATGAAATGG + Intronic
1056451176 9:86718207-86718229 TCTTATATGAATATATTTTATGG + Intergenic
1057480745 9:95443762-95443784 CTTCATATAAATAAATTATATGG + Exonic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1061699211 9:132402814-132402836 CCATATAGGAATAAAATGGAAGG - Exonic
1185987917 X:4856573-4856595 CAATATATGAAGAAATTTGAGGG + Intergenic
1186240172 X:7557035-7557057 GATTATATGACTATATTAGAAGG - Intergenic
1186373174 X:8967602-8967624 CCTTATCTGAAAAATTTAGAAGG - Intergenic
1187091052 X:16097133-16097155 TCATATAAGAATAAATTTGAGGG - Intergenic
1187111678 X:16308244-16308266 CCTTATATAAAACAATGAGAGGG - Intergenic
1187505974 X:19878898-19878920 CCTTAAATGGATAAATTGTATGG + Intronic
1189741715 X:44124338-44124360 TCTTATATGAATAAAATACCTGG + Intergenic
1190761246 X:53439980-53440002 ACTTATATGAAAAAATTATTCGG - Intergenic
1191123446 X:56929206-56929228 CCTTATGTTAACAAATTAAAAGG + Intergenic
1192380586 X:70612253-70612275 GCTTTTAAGAAAAAATTAGAAGG + Intronic
1192730493 X:73798473-73798495 CATTATATAGAAAAATTAGAGGG + Intergenic
1193648935 X:84106692-84106714 CCTCTTTTGAATAAAATAGAAGG - Intronic
1195267014 X:103191632-103191654 CCTTAAATAAACAAACTAGAGGG - Intergenic
1195603646 X:106777142-106777164 TCTTATATAAATAAATCATATGG + Intronic
1195885173 X:109630051-109630073 ACTGATGAGAATAAATTAGACGG + Intronic
1195929162 X:110056038-110056060 CTTTAAATGAATGAATTATATGG - Intronic
1196251091 X:113460778-113460800 CCATCTATGAATAAAGAAGAGGG - Intergenic
1197431496 X:126372049-126372071 CCTAATATGCATAATTTACAAGG + Intergenic
1197589943 X:128396168-128396190 CCTTATATGAAAAATTTAGGAGG + Intergenic
1198942427 X:141971229-141971251 CCTTATAAGAGGTAATTAGAGGG + Intergenic
1201548731 Y:15196221-15196243 CATTAAATGAAAAAATTATATGG - Intergenic