ID: 1038321420

View in Genome Browser
Species Human (GRCh38)
Location 8:26530909-26530931
Sequence CTGAGCCACCACACCTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2243
Summary {0: 1, 1: 3, 2: 16, 3: 280, 4: 1943}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038321420_1038321429 16 Left 1038321420 8:26530909-26530931 CCCAGTTAGGTGTGGTGGCTCAG 0: 1
1: 3
2: 16
3: 280
4: 1943
Right 1038321429 8:26530948-26530970 ACACAGGAGGCTGAGGTGCGAGG No data
1038321420_1038321425 3 Left 1038321420 8:26530909-26530931 CCCAGTTAGGTGTGGTGGCTCAG 0: 1
1: 3
2: 16
3: 280
4: 1943
Right 1038321425 8:26530935-26530957 TGTAGTCCCAGCTACACAGGAGG 0: 423
1: 43679
2: 163047
3: 222459
4: 209647
1038321420_1038321427 9 Left 1038321420 8:26530909-26530931 CCCAGTTAGGTGTGGTGGCTCAG 0: 1
1: 3
2: 16
3: 280
4: 1943
Right 1038321427 8:26530941-26530963 CCCAGCTACACAGGAGGCTGAGG 0: 950
1: 97570
2: 203499
3: 240253
4: 155318
1038321420_1038321430 20 Left 1038321420 8:26530909-26530931 CCCAGTTAGGTGTGGTGGCTCAG 0: 1
1: 3
2: 16
3: 280
4: 1943
Right 1038321430 8:26530952-26530974 AGGAGGCTGAGGTGCGAGGACGG No data
1038321420_1038321423 0 Left 1038321420 8:26530909-26530931 CCCAGTTAGGTGTGGTGGCTCAG 0: 1
1: 3
2: 16
3: 280
4: 1943
Right 1038321423 8:26530932-26530954 GCCTGTAGTCCCAGCTACACAGG 0: 856
1: 75143
2: 196314
3: 241135
4: 177804

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038321420 Original CRISPR CTGAGCCACCACACCTAACT GGG (reversed) Intronic
Too many off-targets to display for this crispr