ID: 1038322195

View in Genome Browser
Species Human (GRCh38)
Location 8:26537801-26537823
Sequence GGTGAAATTTGAACAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 10, 3: 43, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038322195_1038322199 22 Left 1038322195 8:26537801-26537823 CCAGATTTTGTTCAAATTTCACC 0: 1
1: 0
2: 10
3: 43
4: 364
Right 1038322199 8:26537846-26537868 GTAGGTCCAACATTCAAGTCAGG No data
1038322195_1038322197 4 Left 1038322195 8:26537801-26537823 CCAGATTTTGTTCAAATTTCACC 0: 1
1: 0
2: 10
3: 43
4: 364
Right 1038322197 8:26537828-26537850 ATCCAATAACATTCTTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038322195 Original CRISPR GGTGAAATTTGAACAAAATC TGG (reversed) Intronic
901075213 1:6550405-6550427 GATGAGATTTGAGCAAATTCCGG + Exonic
901726419 1:11246305-11246327 GGCCAAATTTGATCAAAGTCTGG - Intronic
902370092 1:16000871-16000893 GGTGAAATCTGAATAAAGCCTGG - Intergenic
902752582 1:18527648-18527670 GGTGAGATTTGAAGATAATCCGG - Intergenic
903228146 1:21905429-21905451 GGTGACATTGGAGCAAAAACTGG - Intronic
903429773 1:23286341-23286363 TGTGAAATGTTAACAATATCAGG + Intergenic
904877144 1:33663995-33664017 GGTGAAATTCAAATAAAGTCTGG - Intronic
905539715 1:38750387-38750409 GCTGATACTGGAACAAAATCGGG - Intergenic
908161376 1:61411777-61411799 GGGCAAATTTGAACAAAGTCTGG + Intronic
908211425 1:61904424-61904446 GGTGAAATCTGAATAAACTACGG - Intronic
908473342 1:64466095-64466117 TGTGAATCTTGGACAAAATCTGG - Intergenic
908951164 1:69565202-69565224 TATGAATCTTGAACAAAATCTGG - Intergenic
909134767 1:71784093-71784115 GGTGGAATTTGAACAGAATTTGG + Intronic
912406706 1:109444988-109445010 GGTGAGTTTTTAACATAATCTGG - Intergenic
912483369 1:110003139-110003161 GGGGAAATTTGAATATAATCTGG + Intronic
912690084 1:111798333-111798355 GGTGACATTTGAACAGCATCTGG - Intronic
913331150 1:117669008-117669030 GGTGGAATCTGAATAAGATCTGG - Intergenic
914763332 1:150616767-150616789 GGTGAAGTTTGAAGTAACTCAGG - Intronic
917215429 1:172673279-172673301 AGTGAAATTTGAACAAGATAAGG - Intergenic
918191005 1:182174497-182174519 GGTGAAATTTGGCCAACAACAGG + Intergenic
918289059 1:183088752-183088774 GGTGGAACTTGAACCAAATCTGG + Intronic
918976748 1:191498028-191498050 GGTGAAATATGTATAAAATATGG - Intergenic
919360816 1:196591770-196591792 AGTTAAATTTGAACATAATTTGG + Intronic
919533372 1:198754197-198754219 GGTGATATTAGAATAAAAACAGG - Intronic
921699831 1:218256059-218256081 TGTGAAATATGAGCAAAATCTGG + Intergenic
921835089 1:219770336-219770358 GGTGACACTTGAACTGAATCTGG - Intronic
921878923 1:220231540-220231562 GTTGATACCTGAACAAAATCAGG - Intronic
923328965 1:232905125-232905147 GGGCAAATTTGAAACAAATCAGG + Intergenic
923527074 1:234780677-234780699 GCTGAAATCTGAAGACAATCAGG + Intergenic
1063150351 10:3331339-3331361 AGTGAAAATTGAAGAAAATGAGG - Intergenic
1063768512 10:9170693-9170715 GATGATATTTGAACATAATGAGG + Intergenic
1064549152 10:16481105-16481127 TGTGAAATTTGAACAATCTGAGG - Intronic
1064866121 10:19882459-19882481 AGTGAAGTTTGAAAAAAATCGGG + Intronic
1065288948 10:24211162-24211184 AGTGATATTTGAACAAAGACAGG + Intronic
1066025670 10:31357407-31357429 GTTGATATTGGAGCAAAATCAGG + Intronic
1066124832 10:32330647-32330669 TCTTAAATTTGAATAAAATCTGG - Intronic
1067169052 10:43890896-43890918 AGTGAAATTTGAACTAAAGAAGG - Intergenic
1067241932 10:44504824-44504846 GGTGAAATCTCAGCAAAATTAGG + Intergenic
1067301791 10:45018166-45018188 TCTGTAAATTGAACAAAATCTGG - Intergenic
1068072488 10:52213278-52213300 GTTCAAATGTGAAGAAAATCAGG + Intronic
1068767151 10:60776377-60776399 AGTGACATTTGAACAAAGGCTGG - Intergenic
1069222093 10:65896590-65896612 GGTGTGATTTTAACAAAACCAGG - Intergenic
1069274631 10:66574310-66574332 GGTGATAATTGAACAAAACATGG - Intronic
1070031998 10:72685980-72686002 GCTGAAATTTGGACAAAACCCGG + Intergenic
1070117593 10:73543707-73543729 GGTGAAATCTGAATAAAGTCTGG - Intronic
1070736901 10:78869313-78869335 GGTGATATTTGAGCAAGACCTGG - Intergenic
1071155208 10:82680255-82680277 GGTGAAATTTGAACCCCAACAGG + Intronic
1073663392 10:105503167-105503189 GGTGAAATTTGAACAAAGTTTGG - Intergenic
1074364871 10:112849797-112849819 AGGGAAATCTGAACAAAATATGG - Intergenic
1074788520 10:116863506-116863528 AGTGAAATTTGAATCAAGTCTGG - Intronic
1075942174 10:126399642-126399664 AGTGAAATCTGAATAAAGTCTGG + Intergenic
1076160334 10:128238770-128238792 TGAGAAATTTAAAGAAAATCAGG + Intergenic
1077702989 11:4458841-4458863 CTTAAAATTTGTACAAAATCAGG + Intergenic
1077923911 11:6661794-6661816 GGTGAAATCAGAACAGAGTCTGG - Intergenic
1078518300 11:12043828-12043850 GGTAAAATTTGAAAAATATATGG - Intergenic
1079985546 11:27196911-27196933 GGTGTAATTTGAACTAACACAGG + Intergenic
1080047869 11:27828049-27828071 GGTGAAAATAGAAGAAAATGGGG + Intergenic
1080126125 11:28735969-28735991 GGTGATATTTGAATTGAATCTGG - Intergenic
1080973025 11:37301910-37301932 GGCTAAATTTGAAACAAATCAGG + Intergenic
1081059777 11:38459953-38459975 GGTTACATGTTAACAAAATCGGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083377204 11:62233873-62233895 GGTGACATTTGTGTAAAATCTGG + Intergenic
1084775931 11:71375514-71375536 GGGCAAATTTGGACAAAAGCTGG - Intergenic
1085043640 11:73341271-73341293 GGTGACATTTGCACTAAAACTGG + Intronic
1086011495 11:82109188-82109210 GGAGGAATGTGAACAAATTCTGG - Intergenic
1086083503 11:82930569-82930591 TATAGAATTTGAACAAAATCCGG - Intronic
1086134446 11:83432383-83432405 GGTGCTATTTGAATAAAATACGG - Intergenic
1087056365 11:93940444-93940466 GGTGAAATGTGAATAAAATGTGG - Intergenic
1087312691 11:96568248-96568270 GAAGAAATTTGAACAAATTTTGG + Intergenic
1088401598 11:109426781-109426803 CTTGAAATTTGAATAGAATCAGG + Exonic
1088631099 11:111774615-111774637 GGTGAAATTTAAGTAAAATCTGG - Intergenic
1090415638 11:126538430-126538452 GGTGACATCAGAACAATATCGGG + Intronic
1091636609 12:2201898-2201920 GGTGACATCCAAACAAAATCTGG + Intronic
1092185245 12:6473946-6473968 GGTGAAATTTGAATAAACTCTGG - Intergenic
1092220870 12:6712477-6712499 GGTGAAAATTGAAAACAATTTGG - Intergenic
1094435715 12:30418806-30418828 GGAGAAGTATGAACAAACTCTGG + Intergenic
1095267986 12:40182171-40182193 TGTGATAATTGAACAAAAGCTGG + Intergenic
1095511790 12:42958995-42959017 GGTGAAATTCACACAGAATCAGG - Intergenic
1095635513 12:44428771-44428793 GGTGACATTTGAGCAGAATCAGG + Intergenic
1096958592 12:55553372-55553394 GGTAAAAGTGGAACACAATCTGG + Intergenic
1097702388 12:62833524-62833546 GGTGAAATTTGAATAAGGTCAGG - Intronic
1097793898 12:63843248-63843270 GGTAAAATTGGAATAAAATCTGG + Intergenic
1098095635 12:66952555-66952577 GGAGAAAAATGAACAAATTCTGG - Intergenic
1099721257 12:86364581-86364603 GGTGAATTTTGCCCAATATCTGG - Intronic
1100305792 12:93348852-93348874 AGTGAAATCTGAATAAAGTCTGG + Intergenic
1100450873 12:94705452-94705474 GGTGACATCTGAACAAAGTGTGG - Intergenic
1100560166 12:95740274-95740296 GGGGAAGTTTGAAGAAAAACTGG - Intronic
1101072292 12:101088293-101088315 AGTGACATTTGAACAAAGACTGG - Intronic
1101525609 12:105526334-105526356 GATGAAATCTAAATAAAATCTGG - Intergenic
1101972986 12:109330064-109330086 GGTGAAATCTCAATCAAATCGGG + Intergenic
1102088849 12:110169294-110169316 GGTGAAATTTGGAGGAAACCAGG - Intronic
1102434036 12:112906529-112906551 GTTAACATTTGAAAAAAATCTGG + Intergenic
1102436859 12:112930716-112930738 GAATAAATCTGAACAAAATCAGG + Intronic
1102756745 12:115347780-115347802 GGTGACATTTGAACAACAATTGG + Intergenic
1102934141 12:116882602-116882624 GGTGAAATGACAACAAAGTCAGG + Intergenic
1103191313 12:119004502-119004524 GGAGAAATCTGAACAAAACTAGG - Intronic
1103256738 12:119548142-119548164 GTAGACACTTGAACAAAATCAGG - Intergenic
1104109561 12:125691868-125691890 GGGGAAATTTGAACACAGACTGG - Intergenic
1105587689 13:21760072-21760094 GGTGAGGTTTGAACACCATCCGG + Intergenic
1105694445 13:22873953-22873975 GTGGAAATTTCAAAAAAATCAGG + Intergenic
1106031309 13:26007636-26007658 GGTGAAATATAAACAAAGGCAGG + Intronic
1106830970 13:33582875-33582897 GGTGAGATTTTGACAAAAACTGG + Intergenic
1107074453 13:36307293-36307315 GGAGAAATTTCAGAAAAATCTGG - Intronic
1107195976 13:37652033-37652055 GGTGAAATCTGTACAAAGTTAGG - Intronic
1108042708 13:46354258-46354280 GGTGAAATCTGAATAAAGCCTGG + Intronic
1108898573 13:55366927-55366949 AGTGAAATTTGAGAAAACTCAGG - Intergenic
1109452546 13:62536819-62536841 TGAAAAATTTGAACCAAATCTGG - Intergenic
1109477331 13:62898243-62898265 GGTGAAATTATATCAAATTCTGG + Intergenic
1110405839 13:75149564-75149586 TGTGAAGTTGGAGCAAAATCTGG - Intergenic
1110613390 13:77514122-77514144 GGTGTGATTAGAACAAAAGCAGG - Intergenic
1111279921 13:86008808-86008830 GGTACAATTTGATAAAAATCTGG + Intergenic
1111555776 13:89879769-89879791 GGTGAAATTGAAACAAGGTCAGG - Intergenic
1112541215 13:100314900-100314922 GGTGAGATTTGAATAAGGTCTGG + Intronic
1112802214 13:103124967-103124989 GGGGAAATTTGGAGAAAATCAGG + Intergenic
1114169409 14:20256718-20256740 GGTGAAATCCAAATAAAATCTGG + Intronic
1114281864 14:21199902-21199924 GGTGAAATCTGAATAAGACCTGG + Intergenic
1114505633 14:23210402-23210424 AATGAGATTTGAACAAAGTCTGG + Intronic
1115048934 14:29032531-29032553 GGTGAAATTTGAATGAAATCTGG + Intergenic
1115880242 14:37908447-37908469 GGAGAAATTTTAACCACATCTGG - Intronic
1117259154 14:54012193-54012215 GGTGAAATATTACCATAATCAGG - Intergenic
1117880773 14:60311359-60311381 GATGAAATTTGAACAGATTATGG - Intergenic
1118567661 14:67160032-67160054 GGAGAAATTTGAATATGATCAGG - Intronic
1119117290 14:72036489-72036511 GCTGAAATTTGAAAATACTCTGG - Intronic
1119170879 14:72535534-72535556 TGGGAAATATGAATAAAATCAGG - Intronic
1120638616 14:86982526-86982548 GGAGAGATTTGAACACAGTCTGG - Intergenic
1124989607 15:34658625-34658647 AATGACATTTGACCAAAATCAGG + Intergenic
1125043992 15:35224969-35224991 AATGAAATATGAATAAAATCTGG - Intronic
1125163043 15:36669607-36669629 GGTGAAATTTGAATTACGTCTGG - Intronic
1127003076 15:54532849-54532871 GGTGAAATTGGAACAGGCTCAGG + Intronic
1128935112 15:71739381-71739403 GGTGAAATTTAAATAAAGTAGGG + Intronic
1129600223 15:76994441-76994463 GGTCAAAATTAAACAAAAACTGG + Intronic
1129701969 15:77773471-77773493 GGTGAGATTTGAACCAATGCAGG + Intronic
1130245871 15:82248128-82248150 TGTGAAGATTAAACAAAATCAGG + Intronic
1130769221 15:86907435-86907457 AGGGAAACTAGAACAAAATCTGG - Intronic
1130845868 15:87744975-87744997 GCTGAAATTTGAATAAGATGAGG - Intergenic
1130886354 15:88095901-88095923 GGTGAAATCTGAGTAAAATTGGG - Intronic
1134740080 16:16535208-16535230 GGTGAAATTCAAATAAAATTTGG - Intergenic
1134927420 16:18176956-18176978 GGTGAAATTCAAATAAAATTTGG + Intergenic
1135420255 16:22301103-22301125 GGTGACATTTGAGCAAAAACCGG + Intronic
1135735939 16:24931789-24931811 AGGGAAATCTGAACAAAATGTGG + Intronic
1139739278 16:69021358-69021380 GGTGACATTTAAACAAAGACTGG - Intronic
1142900658 17:3009540-3009562 GGTGGAATCTTAACAAAGTCAGG - Intronic
1143955867 17:10668578-10668600 GAAGAAATTTGAACATAAACTGG + Intergenic
1144420733 17:15095672-15095694 GCTGAAATATGGACAAAATTTGG + Intergenic
1145774125 17:27515019-27515041 ATTGTTATTTGAACAAAATCAGG + Intronic
1148343063 17:46884890-46884912 GGAGATATTTGAACCAAGTCAGG - Intronic
1148907078 17:50918622-50918644 GGTGGAAGTTGGACAAAGTCTGG + Intergenic
1150383672 17:64740596-64740618 GATGACATTTGACAAAAATCTGG - Intergenic
1150704051 17:67471807-67471829 GGTGAAATCTGAAGAAAGTCGGG - Intronic
1150976973 17:70098792-70098814 GTAGAATTTTGAACAGAATCTGG + Intronic
1153332976 18:3892831-3892853 GGTTAGATTTGAACAAAATATGG - Intronic
1154342569 18:13516396-13516418 GGTGACATCTGAACAAATACAGG - Intronic
1156483340 18:37449708-37449730 GGTGACATTTGAAAAGAAACTGG + Intronic
1158848902 18:61474228-61474250 GAAGAAATTTAAACAACATCAGG - Intronic
1159986852 18:74852432-74852454 GTTAAATTTGGAACAAAATCTGG + Intronic
1161251628 19:3283805-3283827 GGTGAAATTTGAATACCGTCTGG - Intronic
1161945006 19:7430099-7430121 GGTGAAATTTGGATAAAGCCTGG - Intronic
1163097158 19:15067548-15067570 GGTGAAATATGAATAAAACCTGG + Intergenic
1163137494 19:15323225-15323247 AGAGAAATTTGATCAGAATCTGG - Intronic
1163178267 19:15580874-15580896 GGTGAAAATTTAACAACTTCTGG - Intergenic
1163301681 19:16451348-16451370 GGTGACATTTGCAGACAATCAGG + Intronic
1164330138 19:24246433-24246455 AGTCAAATTTGGAAAAAATCTGG - Intergenic
1164533440 19:29065470-29065492 GGTGAAAGTGGAACAAGGTCAGG - Intergenic
1168435328 19:56312585-56312607 GGGGAAATGTGAATAAAGTCTGG + Intronic
924989835 2:303836-303858 ATTGAGATTTGAACAATATCTGG + Intergenic
925540761 2:4965047-4965069 GGTGAAATTATAACAAGAACAGG - Intergenic
925731169 2:6920191-6920213 GGAGAAATGTGAACAAAAGTAGG - Intronic
926954115 2:18274939-18274961 GGTGACCTTTGAATAATATCTGG - Intronic
927823820 2:26293229-26293251 GGTGAAATCTGAATAAAGTCTGG + Intergenic
928074884 2:28255110-28255132 GGGGAAATCTGAACACAAACTGG - Intronic
928334210 2:30382144-30382166 GATGAAATCTGAACACTATCTGG - Intergenic
929192736 2:39154695-39154717 GGTGAAATTCAAATAAAGTCGGG - Intergenic
929243492 2:39676665-39676687 GCTGACACCTGAACAAAATCTGG + Intronic
929657560 2:43749137-43749159 AGTGAAATTTGGATAAAATTTGG + Intronic
930240327 2:48929567-48929589 GTTGAACTTGGAACAAATTCTGG + Intergenic
932020381 2:68079331-68079353 AGTGAAATCTGAATACAATCGGG + Intronic
932537372 2:72613584-72613606 GGTGAAATATGAAGAAAAAATGG - Intronic
933240201 2:79912510-79912532 GGTGATATTTGAAAAAAGGCTGG + Intronic
933611794 2:84444220-84444242 GGTGAATTTTGCCCAATATCTGG - Intronic
934585498 2:95489583-95489605 GGTGAAATCTGATCAAATTTTGG - Intergenic
934593968 2:95587173-95587195 GGTGAAATCTGATCAAATTTTGG + Intergenic
934788813 2:97038508-97038530 GGTGAAATCTGATCAAATTTTGG - Intergenic
935829341 2:106984215-106984237 TGTGAAATATGAGCAAAATAAGG + Intergenic
937435275 2:121874815-121874837 GGTAACATTTGAACATAATTGGG + Intergenic
937776258 2:125779987-125780009 GATTATATTTGAAGAAAATCAGG + Intergenic
938302418 2:130226444-130226466 TTTGAAATTTTAAAAAAATCAGG + Intergenic
938403705 2:131015392-131015414 GAGGAAATCTGAACAAAATCTGG + Intronic
938600665 2:132835663-132835685 GGTAAAATTTGAATGAAAACTGG - Intronic
938844485 2:135194873-135194895 GGATTTATTTGAACAAAATCAGG + Intronic
939076123 2:137605081-137605103 ATTGAAATGTGAACAGAATCTGG - Intronic
939627017 2:144490173-144490195 GGTGGGATTTGAACTATATCTGG - Intronic
939812298 2:146849174-146849196 TGTAAAATTTGTCCAAAATCAGG - Intergenic
939820762 2:146954564-146954586 GGTGACAGGTGAACAAATTCAGG + Intergenic
940476143 2:154165767-154165789 AGTGAAATTAGACCAAGATCTGG + Intronic
941147596 2:161871229-161871251 GGTGAATTTAGAATAAAATTGGG + Intronic
942308618 2:174633194-174633216 GGTAAAATATGAAAAAAATGTGG + Intronic
943229378 2:185227641-185227663 TGTGAATTTAGAACACAATCAGG - Intergenic
943419177 2:187647607-187647629 GGTGAAATTTGCAATAAATTTGG + Intergenic
943654930 2:190498536-190498558 TGTGAAATTTTAACCAAATCTGG + Intronic
944476218 2:200109591-200109613 GGTGTAGTTTGAAAAAAAACAGG - Intergenic
944680021 2:202068823-202068845 GCTGAAATTGGAACCAAATTTGG + Intergenic
944752118 2:202720574-202720596 GGGGAAATTTTAACATAAACTGG - Intronic
944977604 2:205073707-205073729 GGTGTGAATTGAACAAAATATGG - Intronic
945456710 2:210059021-210059043 GGTGAATTTTGCCCAATATCTGG + Intronic
945844688 2:214930130-214930152 TCAGAAATTTAAACAAAATCAGG + Intergenic
947861994 2:233367009-233367031 GGGGAAATTTGAAAATGATCTGG - Intronic
948611640 2:239171590-239171612 GGTGAAGTTTGAGAATAATCAGG + Intronic
1168767816 20:393916-393938 GGTGAAAGTTGAGGAAAAACAGG - Intronic
1169492103 20:6080056-6080078 GGTGACATTTGATCAAAAAATGG + Intronic
1169696103 20:8388435-8388457 GGTGAAATCTGTACAAAGTCAGG - Intronic
1170985247 20:21251903-21251925 GGTGAAATGTGAGTAAAGTCTGG + Intergenic
1171492402 20:25530526-25530548 GGTGAATTTTGCCCAATATCTGG - Intronic
1173410720 20:42807309-42807331 GGTGAACTTTTGACAGAATCTGG - Intronic
1174192564 20:48750642-48750664 GGTGACATTTGAACTAAGGCCGG - Intronic
1174830440 20:53807270-53807292 GGTGACATTTGAACAAAGACTGG - Intergenic
1176710025 21:10142851-10142873 GGTGAATTTTCAACAACATTTGG - Intergenic
1177003842 21:15646466-15646488 AGTGAAATTCAAATAAAATCTGG + Intergenic
1178350141 21:31867008-31867030 GGTGACATTTGAGCAAAGACCGG + Intergenic
1178438331 21:32578800-32578822 GGTGAAATTTTTCCAAAAGCAGG + Exonic
1179661002 21:42875125-42875147 GGTGAATTTTGCCCAATATCTGG + Intronic
1179836602 21:44038801-44038823 GGTGAAATCTGAGGAAAACCAGG - Intronic
1180635565 22:17260525-17260547 GGTAAAATGTTAACAATATCTGG + Intergenic
1182864916 22:33595740-33595762 GGCCAGATTTGGACAAAATCTGG - Intronic
1184869666 22:47227680-47227702 TTTGAATTTTGAAGAAAATCTGG + Intergenic
949289007 3:2441728-2441750 GGTAAAATATGATGAAAATCTGG - Intronic
950115204 3:10446327-10446349 TGTGAATATTGAATAAAATCAGG - Intronic
950998160 3:17527262-17527284 GGTGATATTTGAATAAAGTGAGG + Intronic
951138679 3:19135364-19135386 GGTGAATTTTCAGCAAAATCTGG + Intergenic
951738808 3:25897610-25897632 AATAAAATTTGACCAAAATCTGG - Intergenic
953379884 3:42461732-42461754 GCTGAAAATTAAATAAAATCAGG + Intergenic
953542214 3:43831250-43831272 TGTGAAATTTGAAGAAACTGAGG + Intergenic
953695710 3:45157156-45157178 AGTGAAATTTGAATAAAGTCTGG - Intergenic
953837127 3:46356485-46356507 GGTGGAATTGGAATAAAACCAGG + Intronic
954975000 3:54684998-54685020 GGTGACATTTAATCAAAGTCAGG - Intronic
955048489 3:55384952-55384974 GGTGACATCTGAATAAACTCTGG + Intergenic
956486058 3:69723089-69723111 GGAGAAATCTGAATAAAGTCTGG + Intergenic
957594507 3:82244853-82244875 GTTGACATTTGAACCAAATTTGG - Intergenic
957818632 3:85338679-85338701 GACAAAATTTGAACAAAAACTGG + Intronic
957933246 3:86910361-86910383 GGAGAAATTAGAACAAAGTATGG - Intergenic
958267438 3:91455715-91455737 GGAGAAATCTGAACATGATCTGG + Intergenic
958892762 3:99798930-99798952 GGTTAATTTTGAACTAAATAGGG - Exonic
958914778 3:100037118-100037140 GGTAAAATTTGAATAAAATGTGG + Intronic
959126426 3:102295006-102295028 GGTGAATTTTGCCCAATATCTGG + Intronic
959244199 3:103842658-103842680 GGAGTAAATTGAACAAAATAAGG - Intergenic
959470603 3:106745011-106745033 GGTGAATTTTGCCCAATATCTGG + Intergenic
960194177 3:114745002-114745024 GGTGATCTTTGAAAAACATCAGG + Intronic
960821729 3:121740474-121740496 GGTGAAATGTGAACAACGTCTGG + Intronic
960849144 3:122034430-122034452 GGCAAAAATTCAACAAAATCTGG + Intergenic
963066003 3:141265149-141265171 TGTGAAGTTGGAACAAAGTCTGG + Intronic
963917184 3:150869545-150869567 CTTGATATTAGAACAAAATCAGG - Intergenic
964191732 3:154011034-154011056 TGTTAAATTTGAACCAAATATGG + Intergenic
964764086 3:160161661-160161683 GAGAAAATTTGAATAAAATCTGG + Intergenic
964891143 3:161537072-161537094 GGTGAATTCTGAATAAACTCTGG - Intergenic
965256104 3:166413775-166413797 GGTGACATATGAACAAATTTGGG - Intergenic
965986210 3:174756698-174756720 GGTGAATTTTGAAATAAAGCTGG + Intronic
966345434 3:178973884-178973906 GGTGACTTTTGATAAAAATCTGG - Intergenic
967438919 3:189483830-189483852 GGTAAAATCTGAATAAAATCTGG + Intergenic
967556121 3:190861116-190861138 GGTGAAATTTGTACATATCCAGG + Intronic
970185952 4:13454245-13454267 GTAGAAAATTCAACAAAATCAGG - Intronic
970443117 4:16101746-16101768 GTTAAAATTTGAACAAACACTGG + Intergenic
970500843 4:16675244-16675266 GGTGAAATCTGAATTAAGTCAGG - Intronic
971193825 4:24453075-24453097 GGGGAAATTTGAACACAGGCAGG + Intergenic
973012930 4:45099553-45099575 GCAGACATTGGAACAAAATCAGG + Intergenic
973088230 4:46096374-46096396 GGTAAAACTAGAACAAAAACAGG + Intronic
974591791 4:63958700-63958722 TGTGAAATGTGAAAAAAACCTGG - Intergenic
975100796 4:70510791-70510813 GGTGATTTTTAAACAAAATTAGG + Intergenic
975927238 4:79471768-79471790 GGGGAAATTTCAAGAAAATAGGG + Intergenic
976044076 4:80923819-80923841 GGGGAAATTTGAACACTAACTGG + Intronic
976331721 4:83839620-83839642 GGTGAAATCTGAATAAAATCTGG + Intergenic
976351729 4:84067433-84067455 GGTGAATATTGAACTAGATCAGG + Intergenic
976848458 4:89517068-89517090 AGTGAAATCTGAATAAAGTCTGG - Intergenic
977781729 4:100988316-100988338 GGGGAAATTTGAACAATGGCTGG + Intergenic
978653371 4:111036063-111036085 GATGAAAATTGAACATGATCTGG - Intergenic
979907078 4:126307827-126307849 GGAAAAATTTGAATGAAATCTGG + Intergenic
981536647 4:145807123-145807145 GGTGAAATTCCAACAAATTTTGG - Intronic
981786538 4:148485722-148485744 GGGAAAACTTGAACAAAATGAGG + Intergenic
982372814 4:154653115-154653137 GGTAAAGTTTGAGCAAAATGAGG - Intronic
983839180 4:172435097-172435119 GATGAAATTTTAACAATGTCAGG - Intronic
984149965 4:176116717-176116739 AAAGAAATTTGAACAAAATAAGG - Intronic
984166363 4:176307437-176307459 GGGGAAAATTGAACAAGATGTGG - Intergenic
986421811 5:7592762-7592784 AATTAAATTTGAACAAAAACTGG + Intronic
987939553 5:24515593-24515615 GATGAAATTTGAACAAAGTCAGG - Intronic
989318975 5:40112770-40112792 GGTGAATTTTGCCCAATATCTGG + Intergenic
990874878 5:60473340-60473362 GGTGAAATTTGAATAAAGTTTGG + Intronic
991292632 5:65047399-65047421 GGTGACATTTAAACAGAATTAGG - Intergenic
992300040 5:75368686-75368708 GATGAAATTTGATCACAATTAGG - Intronic
992529057 5:77638076-77638098 GGTGTAATTTGTAAAAAATCTGG - Intronic
992910445 5:81391448-81391470 GGTGAAAAGTGAACAAAAGTAGG - Intronic
993060457 5:83032337-83032359 GGTAAAATTTGAAGAACATCTGG - Intergenic
993811809 5:92488847-92488869 GGTGAAATGCAAACAAAGTCTGG + Intergenic
994713965 5:103299891-103299913 GGTGAAATTCAAATAAAGTCTGG - Intergenic
995072849 5:107944079-107944101 GATGACATTTGAACTGAATCTGG - Intronic
995457269 5:112365652-112365674 AGTGAAATCTGAATAAAATGTGG - Intronic
995990384 5:118231380-118231402 GCTGACATTTGAACAAAAATAGG - Intergenic
996100137 5:119437276-119437298 GGTGAATTTTGCCCAATATCTGG + Intergenic
997151047 5:131495561-131495583 AGAGGAATTTGAAAAAAATCTGG - Exonic
997218750 5:132138791-132138813 GGTTAAATCTGAATAAAGTCTGG + Intergenic
998206998 5:140165112-140165134 GGTGACATTTGAGCAAGATCTGG + Intergenic
998714867 5:144871705-144871727 GGTGAAATCTGAATGAAGTCTGG - Intergenic
999894722 5:156018901-156018923 GTTAAAATTTGATGAAAATCCGG - Intronic
1000109858 5:158098146-158098168 GGGGAGATTTGAACTACATCTGG - Intergenic
1000562710 5:162810464-162810486 GGTGAATTTTGCCCAATATCTGG + Intergenic
1000896413 5:166860704-166860726 GGTTGAATTTAACCAAAATCAGG - Intergenic
1002830168 6:813368-813390 GGGGAAAATGGAACTAAATCAGG - Intergenic
1004183823 6:13404871-13404893 GGTGAAATTTGACCCAAAGGTGG - Intronic
1004776564 6:18853004-18853026 GATGAAATTTGAATAAAATATGG - Intergenic
1004953223 6:20698400-20698422 AGTGAAATCTGAATAAAATGTGG - Intronic
1006658329 6:35616403-35616425 GGTGAAATTCAAATAAGATCTGG + Intronic
1007102331 6:39257873-39257895 GGTAACATTTGAAAAAAGTCTGG - Intergenic
1008523006 6:52380229-52380251 GGTGAGATTTGAGCAAAGACTGG + Intronic
1008864694 6:56195354-56195376 GTTGAAATTTCTACAATATCAGG + Intronic
1008909639 6:56719630-56719652 GGTGAATTTTGCCCAATATCTGG - Intronic
1010326227 6:74565854-74565876 AGTGAAATCTGAATAAAATGTGG - Intergenic
1010540843 6:77090084-77090106 GGTGACATTTGAACAAAGGTTGG - Intergenic
1011950780 6:92960752-92960774 GTTGAAACTTGAGCAAAATGGGG + Intergenic
1012548224 6:100444915-100444937 GTTTAAATTTGAAAAACATCTGG + Intronic
1013342758 6:109230956-109230978 GGTGATATTTGAGCAGACTCTGG - Intergenic
1014032277 6:116719323-116719345 GGTGATTTTTGAACAAATTTCGG + Intronic
1014177551 6:118347221-118347243 AGTATAATTTGAAGAAAATCAGG + Intergenic
1016586744 6:145697084-145697106 GGTGAATTTTGCCCAATATCTGG - Intronic
1017756456 6:157533451-157533473 GGTGATATTTGAGCAAAGGCTGG + Intronic
1018616843 6:165694796-165694818 TGCAAAATTAGAACAAAATCAGG + Intronic
1018721910 6:166579511-166579533 GGTTATATTTAAACAAAATTTGG + Intronic
1018794731 6:167177006-167177028 GGTGAAATTTTTCCAAAAGCAGG - Exonic
1020701735 7:11492641-11492663 AGTGAAATCTGAACAATATTTGG + Intronic
1020721111 7:11746352-11746374 GGTGAAATCCAAATAAAATCTGG - Intronic
1021330544 7:19333609-19333631 AGTAAAATTAAAACAAAATCAGG - Intergenic
1021497245 7:21289535-21289557 GGTAATATTTGAGCAAAAACTGG + Intergenic
1024285536 7:47754198-47754220 AGTAAAATTTAAAAAAAATCTGG - Intronic
1024646437 7:51374943-51374965 GGTGAAATCCCAACAAAGTCTGG - Intergenic
1025173013 7:56778379-56778401 GGTGAAACCTGAATAAACTCGGG - Intergenic
1025830801 7:65047765-65047787 GGTGAAACCTGAATAAACTCAGG + Intergenic
1025917964 7:65881678-65881700 GGTGAAACCTGAATAAACTCAGG + Intronic
1027541828 7:79476707-79476729 GGTGAAATCTGAAGAACTTCCGG + Intergenic
1029221294 7:98992646-98992668 AGTGAAATTTCACCAACATCTGG - Intronic
1030091056 7:105859067-105859089 GGTGAATTTTGAACGAGAACTGG + Intronic
1030287342 7:107840113-107840135 GGTGATCTTTGAACCAAGTCTGG + Intergenic
1030353267 7:108514644-108514666 GTTGAAACTTGAAGAACATCAGG + Exonic
1030385754 7:108866055-108866077 AGTCATATTTTAACAAAATCTGG + Intergenic
1030601483 7:111597705-111597727 GGTGAATTTTGCCCAATATCTGG + Intergenic
1031378258 7:121053614-121053636 GGCAAAATTTGAAGAAAAACAGG - Intronic
1032132188 7:129239296-129239318 TGTGAGATATGAACAATATCAGG + Intronic
1033384319 7:140856744-140856766 GGAGATATTTGAACAGAAGCTGG + Intronic
1033535579 7:142308821-142308843 CATTAAATGTGAACAAAATCTGG + Intergenic
1033539788 7:142345758-142345780 TTTGAAATGTGAACAACATCTGG + Intergenic
1033922200 7:146408114-146408136 GTTGACCTTTGAACAAAATGGGG - Intronic
1034609472 7:152352653-152352675 GGTGAATTTTGCCCAATATCTGG + Intronic
1036759233 8:11495773-11495795 GGTGAAATTTTAACAAGACCTGG + Intronic
1038322195 8:26537801-26537823 GGTGAAATTTGAACAAAATCTGG - Intronic
1038850086 8:31267235-31267257 GGGGAAATTAAAAAAAAATCTGG + Intergenic
1039798000 8:40931817-40931839 GGTGATACTTGAACAGAAACTGG - Intergenic
1039834252 8:41243924-41243946 GGTGAAAGCTGAACAAAGTTTGG - Intergenic
1040042104 8:42926734-42926756 GGTGAAATTTGAATAAAATATGG - Intronic
1040573341 8:48628462-48628484 TGAGAAATTTGAATAAAGTCTGG - Intergenic
1040977148 8:53206062-53206084 GAGGAAAGTTGAACAAAATGAGG - Intergenic
1041367724 8:57126536-57126558 GGTGAAGTTTGAACAAAGTCTGG + Intergenic
1041414035 8:57587729-57587751 GGGGAAATTCTTACAAAATCAGG - Intergenic
1043825750 8:84926799-84926821 TTTGATATTTGAACAAAACCAGG - Intergenic
1045529471 8:102970748-102970770 GGTGCTATTAAAACAAAATCTGG - Intronic
1046345326 8:112917380-112917402 GGTGAAAACTGAACAAGACCTGG + Intronic
1046379556 8:113434420-113434442 GGTGAAATTAAAATAAAATGAGG + Intronic
1049343621 8:142126986-142127008 GGGGAAATCTGAACAAACGCAGG - Intergenic
1049486899 8:142870018-142870040 GCTGAAATATGAACAAAATATGG - Intronic
1049905271 9:210945-210967 GGTGACATTTGAACTAAATCTGG + Intergenic
1050980621 9:12009328-12009350 AGTGAAATATGAAAAAAATGTGG - Intergenic
1051203449 9:14658308-14658330 GGTGAATTTTGAACTATATTGGG - Intronic
1051318119 9:15865818-15865840 GTTGAACTTTGAACAACATGTGG - Intronic
1052472777 9:28921251-28921273 GGTGAAATATGAATAGATTCTGG - Intergenic
1052628887 9:31011185-31011207 TGTGAAATTTGTACAAATGCTGG + Intergenic
1052808896 9:33038798-33038820 GGTGGACTTTGATCCAAATCAGG + Exonic
1053568925 9:39284135-39284157 GGTGCAACTTGAACAAGATTGGG - Intronic
1053758720 9:41335294-41335316 GGTGAATTTTCAACAACATTTGG + Intergenic
1053834892 9:42125170-42125192 GGTGAAACTTGAACAAGATTGGG - Intronic
1054090557 9:60843100-60843122 GGTGAAACTTGAACAAGATTGGG - Intergenic
1054111968 9:61118657-61118679 GGTGAAACTTGAACAAGATTGGG - Intergenic
1054128219 9:61334873-61334895 GGTGCAACTTGAACAAGATTGGG + Intergenic
1054595645 9:67062359-67062381 GGTGAAACTTGAACAAGATTGGG + Intergenic
1055891635 9:81130322-81130344 GGTGACACTTGAACAACATGGGG - Intergenic
1056672932 9:88646751-88646773 GGTTAAATTAGTACAAAATGTGG + Intergenic
1056757473 9:89390951-89390973 GGTGAAATTCCAACAGACTCTGG + Intronic
1056983852 9:91342798-91342820 GCTGACCTTTGAACAACATCAGG + Intronic
1056999021 9:91490536-91490558 GGTGAAATCTGAACAAGTCCTGG - Intergenic
1057561956 9:96135011-96135033 GGTGGAATTTGAGCTGAATCTGG + Intergenic
1057759690 9:97862155-97862177 ACTGAAACCTGAACAAAATCAGG - Intergenic
1058314605 9:103549452-103549474 GGTCAAATTATGACAAAATCTGG - Intergenic
1059245633 9:112847493-112847515 GGGGAAATTTGAACACTAACTGG - Intronic
1060349052 9:122841671-122841693 GGTGAAATCTGAATAAGCTCTGG + Intergenic
1060694907 9:125700783-125700805 GGTGAAAATTGAAGAAATACTGG - Intronic
1061763429 9:132866415-132866437 TGTTAAATTTGCATAAAATCTGG + Intronic
1202794786 9_KI270719v1_random:111846-111868 GGTGAATTTTCAACAACATTTGG - Intergenic
1186546801 X:10458429-10458451 GGTAAAATCTGAATAAAGTCTGG + Intronic
1187178855 X:16923786-16923808 AGTGAAATTTAAACAAATTCAGG - Intergenic
1187430478 X:19219602-19219624 GGGAAAATTTGAATAAATTCTGG - Intergenic
1187922840 X:24222552-24222574 TGTTAAATTTGAATAAGATCAGG - Intergenic
1189514439 X:41698204-41698226 GGAGAAATTTGAAGCAAATATGG + Intronic
1190070488 X:47275264-47275286 GGTGAAATCTGAATACACTCTGG - Intergenic
1190490507 X:50978291-50978313 GGTGCAATCTGAACTAATTCCGG + Intergenic
1190719306 X:53134059-53134081 GGTGAAATTTTCTCAAAAGCAGG + Intergenic
1190883910 X:54513815-54513837 GGTGAAATCTGAATAAAGTTTGG + Intergenic
1190940466 X:55035454-55035476 GGTACAATATCAACAAAATCAGG + Intergenic
1192338811 X:70244643-70244665 GGTGAAATTTGAATAAAGTCTGG + Intergenic
1192835726 X:74797298-74797320 GGTGAAATCTGAATGAAGTCTGG + Intronic
1193352151 X:80475900-80475922 TGGGAAATTTAAACAATATCTGG - Intergenic
1193879927 X:86909664-86909686 GGTGAAATTTGAGGAAAGACAGG - Intergenic
1194243595 X:91481336-91481358 GGTTAAATATGAATAAAATTAGG + Intergenic
1194759007 X:97771766-97771788 GGTGAGATATGAGAAAAATCTGG - Intergenic
1195658023 X:107351733-107351755 GGTGGACTTTGATCCAAATCAGG - Intergenic
1195760586 X:108241969-108241991 GGTGAAATCTGAACAAAATATGG - Intronic
1196003630 X:110812484-110812506 GGTGAAATCTGAATAAAGACTGG - Intergenic
1196466361 X:115975034-115975056 GGTGATCTTTGAATTAAATCTGG - Intergenic
1196636054 X:118003968-118003990 GGTGAAATGCAAACAAAATGAGG + Intronic
1197313387 X:124933574-124933596 GTCGAAATTTTAACAAATTCTGG - Intronic
1197998369 X:132405383-132405405 GGGGAAATCTGAATAAAGTCTGG + Intronic
1198377094 X:136050947-136050969 GGTGCTATTTGAATAAAATACGG + Intergenic
1199784002 X:151087901-151087923 GGTGACATTTGAGCAAAGACTGG - Intergenic
1200562576 Y:4722711-4722733 GGTTAAATATGAATAAAATTAGG + Intergenic
1202365000 Y:24153907-24153929 GGTGAAGAGTAAACAAAATCAGG + Intergenic
1202505781 Y:25516215-25516237 GGTGAAGAGTAAACAAAATCAGG - Intergenic