ID: 1038323485

View in Genome Browser
Species Human (GRCh38)
Location 8:26551126-26551148
Sequence CCCTTTGAGCAGAAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038323479_1038323485 3 Left 1038323479 8:26551100-26551122 CCCAATTATTCTAATCAAAAGCC 0: 1
1: 4
2: 9
3: 53
4: 255
Right 1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG No data
1038323477_1038323485 27 Left 1038323477 8:26551076-26551098 CCTTCATAGACATACCTGGGACA 0: 1
1: 0
2: 5
3: 32
4: 235
Right 1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG No data
1038323478_1038323485 13 Left 1038323478 8:26551090-26551112 CCTGGGACAACCCAATTATTCTA 0: 1
1: 1
2: 4
3: 14
4: 121
Right 1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG No data
1038323480_1038323485 2 Left 1038323480 8:26551101-26551123 CCAATTATTCTAATCAAAAGCCA 0: 1
1: 4
2: 4
3: 38
4: 247
Right 1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038323485 Original CRISPR CCCTTTGAGCAGAAGAGGGA TGG Intronic
No off target data available for this crispr