ID: 1038324983

View in Genome Browser
Species Human (GRCh38)
Location 8:26566300-26566322
Sequence ATTTTTTTGTATCTGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038324983_1038324998 22 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038324998 8:26566345-26566367 GGGCCCTGCAGGAGAAAGGAGGG No data
1038324983_1038324993 11 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038324993 8:26566334-26566356 CCTCCCTAAAGGGGCCCTGCAGG No data
1038324983_1038324986 0 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038324986 8:26566323-26566345 CACGGGATCCCCCTCCCTAAAGG No data
1038324983_1038324987 1 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038324987 8:26566324-26566346 ACGGGATCCCCCTCCCTAAAGGG No data
1038324983_1038325001 28 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038325001 8:26566351-26566373 TGCAGGAGAAAGGAGGGAATTGG No data
1038324983_1038324988 2 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038324988 8:26566325-26566347 CGGGATCCCCCTCCCTAAAGGGG No data
1038324983_1038324996 18 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038324996 8:26566341-26566363 AAAGGGGCCCTGCAGGAGAAAGG No data
1038324983_1038324997 21 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT No data
Right 1038324997 8:26566344-26566366 GGGGCCCTGCAGGAGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038324983 Original CRISPR ATTTTTTTGTATCTGAGCCC AGG (reversed) Intronic