ID: 1038324993

View in Genome Browser
Species Human (GRCh38)
Location 8:26566334-26566356
Sequence CCTCCCTAAAGGGGCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038324983_1038324993 11 Left 1038324983 8:26566300-26566322 CCTGGGCTCAGATACAAAAAAAT 0: 1
1: 0
2: 2
3: 17
4: 328
Right 1038324993 8:26566334-26566356 CCTCCCTAAAGGGGCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038324993 Original CRISPR CCTCCCTAAAGGGGCCCTGC AGG Intronic
No off target data available for this crispr